Labshake search
Citations for Merck :
451 - 500 of 4140 citations for 7 CHLORO 1 METHYL 1H PYRAZOLO 4 3 B PYRIDINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Murine lungs were perfused and fixed overnight at 4 °C in 4% paraformaldehyde (Merck Millipore) under agitation ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were incubated overnight at 4 °C with a monoclonal anti-RBPMS antibody (1:500, Rabbit, ABN1362, Merck Millipore) for the retina ...
-
bioRxiv - Immunology 2021Quote: ... were coated overnight at 4 °C with 100 µL of lysate diluted at 1:40 in carbonate buffer (Merck). After a blocking step with PBS with 4 % milk for 1 h ...
-
bioRxiv - Biochemistry 2021Quote: ... and soluble protein was clarified by centrifugation (50,000×g, 1 h, 4°C) and subsequently passed through a 0.22-μm filter (Merck Millipore).
-
bioRxiv - Bioengineering 2022Quote: ... samples were fixed in a solution of 4 % (v/v) paraformaldehyde supplemented with 1 % (v/v) glutaraldehyde (Merck, USA) overnight at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 2 % (vol/ vol) FCS and and 10 mM 4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES, Merck) and cut into 1 cm pieces ...
-
bioRxiv - Physiology 2020Quote: ... Membranes were probed overnight at 4°C with anti-phosphotyrosine antibody (1/1000, 05-321, clone 4G10, Merck Millipore) in blocking solution ...
-
bioRxiv - Immunology 2022Quote: ... The sections were incubated overnight at 4°C with the following primary antibodies: KRT8 (Merck Millipore, MABT329, 1:100), p-ERK (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2023Quote: ... concentration and buffer exchange to TE (10 mM Tris-HCl pH7.5 and 1 mM EDTA) with an Amicon Ultra-4 centrifuge filter unit42 (30 kDa cut-off, Merck). Concentration of all plasmids was measured by NanoDrop One (Thermo Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated for 24 h at +4°C with primary antibodies (goat anti-Chat (1:200, Merck, AB144P), mouse anti-GFAP (1:300 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were dissociated by using an Enzyme-Free Cell Dissociation Solution (S-014-B, Merck Millipore) and washed twice in wash buffer (50mM Tris-HCl ...
-
bioRxiv - Molecular Biology 2021Quote: ... mESCs were re-plated in serum- free ESGRO Complete Clonal Grade medium (Merck, Cat# SF001- B). The list of 4DN sample IDs is provided in Supplemental Table 6.
-
bioRxiv - Immunology 2023Quote: ... 2 and 3 were detected with another multiplex assay (MILLIPLEX MAP TGFß Magnetic Bead 3 Plex Kit; Merck Millipore).
-
bioRxiv - Cell Biology 2022Quote: ... 1 × 105 Cas9 TNG MKOS MEFs were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transduced with either a non-targeting control sgRNA or Zfp266 sgRNA lentivirus at an MOI of 3 with 8 µg ml−1 Polybrene (Merck-Millipore) for 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: The pure protein recovered after HPLC purification in 1% acetic acid was concentrated in Amicon Ultra-15 (cut-off 3 kDa) centrifugal filter units (Merck Millipore) to reach the final protein concentration of 1 mM ...
-
bioRxiv - Cell Biology 2022Quote: ... The selected elution fractions (1-3 of 500 μL each) were pooled and subsequently concentrated using 100-kDa Amicon centrifugal filter units (Merck Millipore). The concentrated samples were subjected to several washing steps with PBS to obtain a highly pure EV population ...
-
bioRxiv - Neuroscience 2022Quote: ... and 3% BSA followed by overnight incubation at room temperature with rabbit anti-KCC2 IgG (1:1000 dilution; #07-432, Merck-Millipore) (Yassin et al. ...
-
bioRxiv - Cell Biology 2023Quote: J774A.1 macrophages with or without infection (3 hour) were lysed in a specific lysis buffer containing DCP-Bio1 (Merck # NS1226) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... samples were washed in PBS for 3 times and Alexa Fluor 555 conjugated secondary goat anti-mouse IgG antibody (1:100; Merck, Germany) was added for immunostaining in the dark for 2 hours at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with a cocktail of 1:100 phosphatase inhibitors cocktail 2 and 3 (Sigma/Merck, P5726-1ML and P0044-1ML, respectively) and 1:100 protease inhibitor cocktail (Sigma/Merck ...
-
bioRxiv - Plant Biology 2021Quote: ... Individual sporophytes were subsequently transferred to GA-7 Magenta boxes (Merck Life Science UK Ltd., Dorset, UK) containing 100ml C-fern agar media when two fronds were visible (10-14 days old) ...
-
bioRxiv - Neuroscience 2022Quote: ... They were recorded in the presence of 10 mM CNQX (6-cyano-7-nitroquinoxaline-2,3-dione, Merck) and 50 mM D-AP5 (D-2-amino-5-phosphonovalerate ...
-
bioRxiv - Genomics 2023Quote: ... All sections from each sample were homogenised using a 7 ml glass Dounce tissue grinder set (Merck) with 8–10 strokes of a loose pestle (A ...
-
bioRxiv - Genomics 2020Quote: ... Teratomas that developed within 4 weeks post-injection were harvested and fixed in 4% paraformaldehyde (Merck), embedded in paraffin ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed using 4% paraformaldehyde (Merck, 1040051000) in PBS and permeabilized by CSK buffer (25 mM HEPES pH 7.8 ...
-
bioRxiv - Genetics 2021Quote: ... fixed with 4% paraformaldehyde (PFA, Merck) in PBS (pH = 7.5) ...
-
bioRxiv - Cell Biology 2020Quote: ... and fixed in 4% paraformaldehyde (Merck) overnight at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4 μg/ml heparin (Sigma/Merck), 20 ng/ml EGF (Peprotech) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 4 g/l thiamine-HCl (Merck), and 40 g/l myo-inositol (Merck) ...
-
bioRxiv - Genomics 2020Quote: ... and Tubulin beta 4 (#T7941, Merck). To do so ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM glutamine (Merck KGA, Germany), 1 mM sodium pyruvate (Merck KGA ...
-
bioRxiv - Bioengineering 2023Quote: ... MOWIOL 4-88 Reagent (475904, Merck); LysoTracker Deep Red (L12492 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-Hydroxytamoxifen (4OHT) (Merck Sigma-Aldrich) was added at a final concentration 100 nM for 10-12 hours to induce the recombination of the Lynflallele.
-
bioRxiv - Neuroscience 2023Quote: ... followed by 4 % PFA (1004005, Merck) (w/v ...
-
bioRxiv - Bioengineering 2023Quote: ... 4 μg/mL PI (Merck, Germany) and 12 μg/mL Hoechst 33342 (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2024Quote: ... were fixed with 4% formaldehyde (Merck) diluted in PBS 1X for 10 min at room temperature and then washed 3 times with PBS 1X ...
-
bioRxiv - Microbiology 2021Quote: ... and human lung epithelial cell lines (Calu-3) were expanded in high glucose DMEM (Vero) or MEM (Calu-3) with 10% fetal bovine serum (FBS; Merck), with 100 U/mL penicillin and 100 μg/mL streptomycin (Pen/Strep ...
-
bioRxiv - Microbiology 2021Quote: ... the pUL21 gene was amplified from virus stock by PCR with the oligonucleotide primers 5′-ATGGAGCTTAGCTACGCCAC-3′ and 5′-TTTATTGGGGTCTTTTACACAGACTGTC-3′ using KOD polymerase (Merck) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 100 pM of synthetic guide RNA (Tspan8 guide sequence 5’ – 3’: GGGGAGTTCCGTTTACCCAA; Thrsp guide sequence 5’ – 3’: AGTCATGGATCGGTACTCCG; Merck) were mixed and incubated at RT for a minimum of 10min to assemble the ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... 250 ng of each plasmid encoding VN and VC were transfected using 4 μL of 1 μg/mL PEI (Merck) for each μg of DNA ...
-
bioRxiv - Biophysics 2021Quote: ... fluorescently-labeled and biotinylated H57-scFV were concentrated to 0.2 - 1 mg/mL with 10 kDa Amicon®Ultra-4 centrifugal filters (Merck) and stored in 1x PBS supplemented with 50 % glycerol at -20°C ...
-
bioRxiv - Neuroscience 2019Quote: ... Membranes were blocked in 5% milk in TBS-T and incubated overnight at 4°C with the primary antibodies anti-tyrosine hydroxylase (1:1,000; AB152; Merck Millipore) or anti-dopa decarboxylase (1:500 ...
-
bioRxiv - Genetics 2020Quote: ... Bone tissue was cut into 2-mm pieces and placed in PBS buffer containing 4% paraformaldehyde (Schuchardt, Muenchen, Germany) and 1% glutaraldehyde (Merck, electron microscopy grade ...
-
bioRxiv - Neuroscience 2021Quote: ... After washing the sections were incubated overnight at 4°C with anti-NeuN antibody (1:1000, Merck Millipore, Cat. # ABN90P) in 1% normal goat serum and 0.1% Triton-X-100 in TBS ...
-
bioRxiv - Neuroscience 2020Quote: ... The blots were blocked in PBS/ 0,05%Tween20 containing 5% skim milk and then probed with the following primary antibodies over night at 4°C: mouse anti-P53 (1:100, Merck), rabbit anti-H2AX (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... then dialysed against the same stock of ITC buffer overnight at 4°C using 1 kDa Pur-a-lyzer tubes (Merck). Protein and RNA concentrations after dialysis were calculated by A280 and A260 absorbance respectively ...
-
bioRxiv - Physiology 2020Quote: ... blocked in 5% NGS and 0.5% Triton diluted in PBS and incubated over night at 4°C with primary antibody: rabbit anti-NG2 (1/50, AB5320, Merck), goat anti-PDGFRα (1/200 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and CM was concentrated to 1 ml at 4 °C using a 10 kDa Centricon Plus-70 centrifugal unit (Merck Millipore ...
-
bioRxiv - Plant Biology 2019Quote: ... 2.5 mM desthiobiotin [IBA]) and concentrated to a final volume of about 1 mL using Amicon Ultra-4 30 K filters (Merck). Purity of proteins was analyzed by SDS-PAGE using 10 % Mini-PROTEAN® TGX™ Precast Gels (BioRad ...