Labshake search
Citations for Merck :
451 - 500 of 5891 citations for 7 tert butoxycarbonyl 5 6 7 8 tetrahydro 1 2 4 triazolo 4 3 a pyrazine 3 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... using GeneJuice transfection reagent (Merck, ref: 70967-3) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% bovine serum albumin (BSA, Merck/Sigma-Aldrich) in PBS was added as blocking buffer and incubated for 1 hour ...
-
bioRxiv - Developmental Biology 2024Quote: ... passed through 3 drops of Advanced KSOM (Merck) and kept for 30 minutes in a drop of KSOM (Merck ...
-
bioRxiv - Immunology 2020Quote: ... rAAVDJ or rAAV6 genome plasmid and Donor plasmid at a 3:1:1 ratio in Polyethylenimine (PEI)(Merck). In total each plate was teransfected with 41,250ng of DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... slides were washed 3×10 min in PBS and counterstained with PI (Merck, 1:500) and p-Phenylenediamine dihydrochloride (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... and 188 μM L-α-phosphatidylcholine: L-α-phosphatidylinositol PC:PI (3:1) (Merck, Darmstadt, DE). 1.5 ml of 0.1 M potassium phosphate buffer ...
-
bioRxiv - Biophysics 2023Quote: ... The final purified protein was concentrated to 1 mM using Amicon (3 kDa cutoff, Merck) and exchanged with NMR buffer D (10 mM sodium phosphate ...
-
bioRxiv - Molecular Biology 2023Quote: ... 20 15 cm dishes were seeded and the nuclear translocation of SAMD1 was induced 24 h before extract preparation by adding 200 nM 4-OHT (Merck; 68392-35-8). After collection ...
-
bioRxiv - Developmental Biology 2022Quote: Zebrafish and medaka samples from different developmental stages harbouring mutations in vsx genes were deeply anesthetized for 5-10 minutes with 160 mg/L of tricaine (ethyl 3-aminobenzoate methanesulfonate salt; MS-222; Merck) before dissecting their heads ...
-
bioRxiv - Biophysics 2021Quote: ... The eluted sample was exchanged into 20 mM Tris buffer and concentrated to 5 ml by Amicon Ultra-15 3 kDa (Merck). The sample was purified by 320 ml of HiLoad Superdex with a flow rate of 1 ml/min using the FPLC systems.
-
bioRxiv - Biophysics 2022Quote: ... was amplified via PCR with the restriction sites 5′-BamHI/XhoI-3′ (Fw Primer: ATATGGATCCATGTTCGTGTTCCTGGTTCTT; Rv Primer: AATATGAGCAGTACATAAAATGGCCCCTCGAGATAT; purchased from Merck). As vector system ...
-
bioRxiv - Biophysics 2022Quote: ... C-CaM was cloned using PCR amplification of the C-terminus of WT-CaM with added flanks of a 5’ NdeI overhang and a 3’ BamHI overhang and ligated into pET21a vector (Merck). Insertion of PCR product into pET21a was achieved with standard protocols (NEB).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were caught and rinsed in 1x PBS (3 × 15 min) prior to incubation in blocking solution (5% NDS (Merck) in 0.3% PBS-Triton-X-100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) and cells were fixed 5–6 days later ...
-
bioRxiv - Microbiology 2023Quote: ... The remaining 32P-γ-ATP was removed by washing with 3 column volumes of Millipore water and centrifugation in 10 kDa (Qβ-RNA) or 3 kDa (8mer) Amicon filters (Merck Millipore) at 14,000 rpm at 4 °C for four times ...
-
bioRxiv - Neuroscience 2019Quote: ... followed by 4% paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; 4% PFA in PB, pH 7.4; Merck).
-
bioRxiv - Immunology 2021Quote: ... was mixed 1:1 and incubated at RT for 2-3 min or ECL substrate is added (Immobilon crescendo western HRP substrate, WBLUR0100, Merck). Membranes were then exposed to film and developed or visualised by chemiluminescence using the G:BOX Chemi gel doc Imaging System Instrument (Syngene) ...
-
bioRxiv - Neuroscience 2021Quote: Viability of SH-SY5Y cells after treatments with or without H-LIPEF was assessed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Biochemistry 2022Quote: ... The purified proteins were concentrated to 2 mg/mL using centrifugal filters with either 3 kDa or 30 kDa cut-off (Amicon Ultra-0.5, Merck/Millipore) and the samples were centrifuged at 100,000 g ...
-
bioRxiv - Genetics 2021Quote: ... At day 10 cells were passaged at a 2:3 ratio into 12 well cell culture plates coated with 15 µg/ml human plasma fibronectin (Merck) in Dulbecco’s phosphate-buffered saline (DPBS ...
-
bioRxiv - Pathology 2023Quote: ... To prevent unspecific labelling the sections were incubated for 2 × 10 minutes in PB solution containing 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Microbiology 2023Quote: ... were pre-prepared by washing 3 times in immunoprecipitation buffer then resuspended in 200μl immunoprecipitation buffer and coated with 2 μl FLAG M2 (Merck Millipore) or IgG (Merck Millipore ...
-
bioRxiv - Biophysics 2023Quote: ... The C378A or C406A variants of 15N-pm-β2AR-Cter were labeled on the remaining cysteine using 3-(2-Iodoacetamido)-proxyl (Merck). Paramagnetic samples were recorded with a recycling delay of 2 s ...
-
bioRxiv - Neuroscience 2023Quote: ... To avoid unspecific labelling the sections were first incubated for 2 × 10 minutes in a solution of PB with 3% hydrogen peroxide (Merck Life Science AS/Sigma Aldrich Norway AS ...
-
bioRxiv - Genomics 2023Quote: ... DNA was fragmented in a 2 mL low-bind round bottom Eppendorf tube using a sterile 3 mm borosilicate bead (Z143928-1EA Merck) by vortexing for 1 minute at maximum speed as described in [23] ...
-
bioRxiv - Molecular Biology 2024Quote: ... the beads were washed 3 more times with 100 µL lysis buffer 2 supplemented with 100 µg/mL polyU RNA (Merck). The bound complexes were eluted in lysis buffer 2 containing 25 mM glutathione or 5 mM biotin (Merck) ...
-
bioRxiv - Neuroscience 2024Quote: ... animals at the age of 3 months were perfused using 2% Formaldehyde (Science Services, München, Germany) and 2.5% Glutaraldehyde (Merck, Darmstadt, Germany) in 0.1M Cacodylate buffer ...
-
bioRxiv - Immunology 2024Quote: The viabilities of the PBMCs or U-937 macrophages were analyzed by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich; Merck KGaA) assay ...
-
bioRxiv - Microbiology 2021Quote: ... were diluted 1:500 in 4% bovine serum albumin (BSA) (Sigma-Aldrich, Merck, UK).
-
bioRxiv - Microbiology 2024Quote: ... samples maintained at 4°C were eluted through a ZIC-pHILIC column (5 μm, polymeric, 150 by 4.6 mm; SeQuant, Merck) by mobile phase A (20 mM ammonium carbonate ...
-
bioRxiv - Genomics 2024Quote: ... media was changed for 500 µL of DMEM +5% FBS +4 μg/mL of polybrene (Merck TR-1003-G). Lentiviruses were diluted to the desired MOI in 500 µL of DMEM +5% FBS and slowly added to each well ...
-
bioRxiv - Bioengineering 2023Quote: ... The 1.5 ml resuspended RBCs were cultured in 50 ml HPS containing 2 mM CaCl2 and 2 µM calcium ionophore-4-bromo-A23187 (C7522, Sigma-Aldrich, Merck KGaA, Darmstadt, Germany) in T75 flasks in a 5% CO2 incubator at 37°C for 16 h ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were fixed with 4% paraformaldehyde (Merck) for 10 min at room temperature ...
-
bioRxiv - Genomics 2020Quote: ... 250 U/mL benzonase (Merck, 70746-4)) on ice for 1 hour prior to centrifugation at 4°C (20kg ...
-
bioRxiv - Microbiology 2019Quote: ... Fmoc-Lys(Biotin)-OH (4 eq; Merck) in 6 ml DMSO:NMP (1:1 ...
-
bioRxiv - Biophysics 2021Quote: ... 4 mM CaCl2 (Merck Life Science, Norway) and 25 μM fluorescein sodium salt (Merck Life Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.8×10-4 M adenine (Merck, A3159), 0.5 µg/ml hydrocortisone (Merck ...
-
bioRxiv - Pathology 2022Quote: ... fixed (4% paraformaldehyde; Merck, #1.04005.1000 in PBS)(24h ...
-
bioRxiv - Cancer Biology 2022Quote: ... 100 nM 4-hydroxy-tamoxifen (OHT; Merck) was added to the medium 48 hours before treatment with IACS-010759 or other drugs ...
-
bioRxiv - Immunology 2020Quote: ... and Polybrene (4 μg/ml; Merck Millipore) in a total volume of 7 ml (2 ml of a 15-min-preincubated transfection mix in serum-free DMEM added to 5 ml of fresh full DMEM) ...
-
bioRxiv - Physiology 2021Quote: ... and fixed with 4% paraformaldehyde (Merck, 104004), prior to fluorescent quantitation.
-
bioRxiv - Cancer Biology 2020Quote: ... fixed in 4% paraformaldehyde (Merck, Darmstadt, Germany) and subjected to flow cytometric analysis on a BD FACS Canto II (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... MOWIOL 4-88 (Calbiochem, Merck-Millipore, UK) mounting media was used in combination with 1 μg·mL-1 DAPI in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... galactose-4-sulfate was purchased from Merck KGA (Germany).
-
bioRxiv - Neuroscience 2022Quote: ... followed by 4% paraformaldehyde (PFA) (1004005, Merck) (w/v ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μg/ml α-Glucosidase (Merck) and incubated at 37℃for 30 mins ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were fixed with 4% paraformaldehyde (Merck) for 10 min and permeabilized for 5 min at room temperature with 0.1% Triton X-100 ...
-
bioRxiv - Bioengineering 2023Quote: ... fixed with 4% para-formaldehyde (PFA, Merck) for 20 min at room temperature (RT ...
-
bioRxiv - Plant Biology 2023Quote: ... and α-amylase (4 U/ml, Merck) in 200 mM sodium acetate– acetic acid ...
-
bioRxiv - Neuroscience 2023Quote: ... and fixed with 4% paraformaldehyde (Merck Millipore) solution for 15 minutes at room temperature ...