Labshake search
Citations for Genesee Scientific :
51 - 76 of 76 citations for U Bottom Microplate 96 well since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 6-well culture plates with glass cover slips (Genesee, Fisher), 96 well plates (Costar) ...
-
bioRxiv - Neuroscience 2022Quote: ... muscae by first embedding eight sporulating Canton-S cadavers in a 2.3 cm-diameter disc of ∼3.5 mm thick 5AS that was transferred with 6” forceps into the bottom of an empty wide-mouth Drosophila vial (Genesee #32-118). A ruler was used to mark 1.5 cm above the top of the disc ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... planarians were kept in 12-well plates (Genesee Scientific, San Diego, CA), with 6 planarians per well and a total volume of 1.2 mL ...
-
bioRxiv - Cell Biology 2022Quote: ... and 8 after being plated in 12-well plates (Genesee, catalog # 25106) in triplicate at a density of 40,000 cells/well ...
-
bioRxiv - Biochemistry 2023Quote: Tissue culture 6-well plates (Genesee Scientific, USA; cat. no. 25-105)
-
bioRxiv - Neuroscience 2023Quote: ... Cells were grown in 12-well culture plates (Genesee Scientific; 25-106); HEK293T cells were transfected 1 day after splitting ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CRFK cells were cultured in a 6-well tissue culture plate (Genesee Biotek). At approximately 75-85% cellular confluency ...
-
bioRxiv - Neuroscience 2023Quote: HEK293T cells were seeded in a 6-well plate (Genesee Scientific, 25-105) at a density of 0.2 x 106 in 2 ml of complete media as described above ...
-
bioRxiv - Neuroscience 2022Quote: ... neurons were cultured in 12-well plate cell culture plates (Genesee Scientific; 25-106) and co-transfected with SYP-GFP and SYT1-HaloTag or HaloTag-SYT1 on 9 DIV using Lipofectamine LTX Reagent with PLUS Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: Cells were plated in 24-well clear tissue culture-treated (Genesee Scientific, San Diego) plates and compounds were pre-treated as stated for 16 h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 24 h starved polyps were incubated in 6-well plates (Genesee Scientific, El Cajon, CA), 8 or 10 animals per well in 2 mL of different concentrations of linalool (0-10 mM ...
-
bioRxiv - Immunology 2020Quote: All immunoprecipitation experiments were conducted in 2 ml deep-well polypropylene plates (Genesee Scientific, Inc). Plates were blocked with 3% BSA in TBST overnight with overhead rotation on a Rotator Genie prior to use for immunoprecipitations ...
-
bioRxiv - Cell Biology 2022Quote: Glass coverslips (Fisherbrand, 12-545-80) were placed in 24-well plates (Genesee Scientific, 25-107) and coated in 3 μg/mL of fibronectin (EMD Millipore ...
-
bioRxiv - Biophysics 2022Quote: Glass coverslips (Fisherbrand, 12-545-80) were placed in 24-well plates (Genesee Scientific, 25-107) and coated in 3 μg/mL of fibronectin (EMD Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... HEK293T cells were seeded the day prior to transfection in a 24-well plate (Genesee, El Cajon, CA) with 500 µl complete media ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293T cells were seeded the day prior to transfection in a 24-well plate (Genesee, El Cajon, CA) with 500μl complete media ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... with the 5 concentrations and the 0.5% DMSO control in separate rows of each 48-well plate (Genesee Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Clonal lines were produced via dilution by plating 0.5 cells per 48-well plate (Genesee Scientific, Morrisville, NC) and visual confirmation of single-cell deposition ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were then diluted 10-fold with TSB supplemented with 2.5% of a carbon source in a 6-well cell culture plate (Genesee Scientific). The plate was overlaid with two AeraSeal sealing membranes (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... NIH 3T3s were transfected at 50–75% confluence in 6-well tissue culture plates (25-105; Genesee Scientific, El Cajon, CA) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2024Quote: ... Flies are then maintained on an egg laying medium with a layer of wet yeast on top in 48-well cell culture plates (Genesee Scientific, 25-103) for a 24-hour “pre-egg laying period.” This provides time for the small cohorts of flies in each well to become accustomed to the new environment and receive a uniform nutritional experience before the fecundity measurements begin.
-
bioRxiv - Developmental Biology 2024Quote: ... Subsequently, the cortical cells were plated in microfluidic axon isolation silicon device (Xona Microfluidics, #snd150) or 12-well plates (Genesee Scientific, #25-106) pre-coated with neuron coating solution I (Sigma-Aldrich ...