Labshake search
Citations for Genesee Scientific :
51 - 99 of 99 citations for Cis Dcca 100 Ug Ml In Acetonitrile D3 1 Carboxyl 13C2 99%; 1 D 97% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Tegosept (79.55 ml, Genesee Scientific, San Diego, CA, USA), were added ...
-
bioRxiv - Molecular Biology 2022Quote: ... For transmission electron microscopy experiments Human hepatoma (HuH-7) wild type and YBX-1 KO cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Genesee Scientific, San Diego, CA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 ml/L 1M Propionic Acid (Genesee Scientific, cat. #789177), 15 ml/L 10 % w/v Tegosept in Et-OH 96 % (Genesee Scientific ...
-
bioRxiv - Biochemistry 2023Quote: 25 ml serological (Genesee Scientific, USA; cat. no. 12-106)
-
bioRxiv - Biochemistry 2023Quote: 50 ml serological (Genesee Scientific, USA; cat. no. 12-107)
-
bioRxiv - Biochemistry 2023Quote: 5 ml serological (Genesee Scientific, USA; cat. no. 12-102)
-
bioRxiv - Biochemistry 2023Quote: 10 ml serological (Genesee Scientific, USA; cat. no. 12-104)
-
bioRxiv - Genetics 2023Quote: ... 79.7 mL/L molasses (Flystuff Genesee Scientific, San Diego CA), 35.9 g/L yeast (Genesee Scientific ...
-
bioRxiv - Genetics 2024Quote: ... at 0.2 g/ml and agarose powder (Genesee Scientific, 20101) at 0.02 g/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... VA) was purchased and maintained in DMEM-10 (DMEM with 10% fetal bovine serum and 1% penicillin/streptomycin: Genesee Scientific, San Diego, CA). C8-D1A cells were modified to express an inducible CreERT2 protein (known further as C8-D1A-CreERT2 astrocytes ...
-
bioRxiv - Genetics 2021Quote: Flies were grown and maintained on food consisting of the following ingredients: 1 part of Nutri-Fly® GF (Genesee Scientific, cat. 66-115) and 3 parts of Jazz-mix (Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... elegans HK males and females were transferred to 60 mm embryo lay cages (GENESEE Part Number: 59-100) on top of 60 mm grape plates (3% agar + 25% grape juice + 0.3% sucrose ...
-
bioRxiv - Genetics 2020Quote: Dissociated whole spleens and bone marrow cells were passed through 100 μM Nitex nylon mesh (Genesee Scientific Products) with phosphate-buffered saline containing 0.5% bovine serum albumin and 2 mM EDTA (PBS/BSA/EDTA) ...
-
bioRxiv - Developmental Biology 2020Quote: ... the membrane was used on Autoradiography Film (5×7, Blue Devil, Premium, 100 Sheets/Unit, Genesee Scientific/Amazon) to visualize location of protein.
-
bioRxiv - Physiology 2023Quote: ... It was thus inevitable to immobilize ticks with 100% CO2 using a diffusing pad (Genesee Scientific, #59-119) positioned under a stereomicroscope (Zeiss ...
-
bioRxiv - Neuroscience 2019Quote: ... Blots were developed using LumiGLO Chemiluminescent Substrate (KPL# 546100) on Blue Devil X-ray Films (Genesee Scientific #30-100). To test for specificity of the antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... The jelly coat of unfertilized eggs was removed by passing them through a 100-μm Nitex mesh (Genesee Scientific) three times to facilitate egg adhesion on protamine-coated glass-bottom dishes (MatTek Corporation) ...
-
bioRxiv - Immunology 2023Quote: Macrophages were seeded at 1x106 cells/well in 6-well non-TC treated plates (Genesee Scientific, Cat. 25-100). Cells were infected as described above ...
-
bioRxiv - Biochemistry 2023Quote: ... supplied with 7 ml of Dulbecco’s Modified Eagle’s Medium (Genesee, #25-500) containing 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2023Quote: 500 ml sterile filter units (Genesee Scientific, USA; cat. no. 25-227)
-
bioRxiv - Developmental Biology 2022Quote: ... An equal amount (15 ml) of fly food medium (Molasses Formulation, Genesee Scientific) was used in each vial.
-
bioRxiv - Evolutionary Biology 2019Quote: ... the optimal egg-laying age as determined by a pilot study) were left in small embryo collection cages (Genesee Scientific, #59-100) for 6 hours with 60 x 15 mm Falcon polystyrene petri dishes filled with 3% agar in organic apple juice with a dab of Fleischmann’s active dry yeast paste ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 330 mg of 0–5-day-old Canton-S flies were transferred to a small embryo collection cage (Genesee #59-100) which was topped with the dish containing the cadavers ...
-
bioRxiv - Biophysics 2021Quote: ... and the cleared supernatant was applied to a 5 ml Ni2+ column (Genesee or Cytivia) and eluted with a 15 column volume gradient from 0-100% Ni2+ B buffer (Buffer A plus 250 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 ml/L 10 % w/v Tegosept in Et-OH 96 % (Genesee Scientific, cat. #789063) per liter ...
-
bioRxiv - Biophysics 2020Quote: ... the growth medium was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA). INS-1E cells were obtained from Addexbio Technologies (San Diego ...
-
bioRxiv - Neuroscience 2021Quote: ... passaging NSCs in conical tubes manufactured by Genesee (15 mL conical tubes, Cat#28-103) resulted in death of the NSC cultures within 1 week of brief exposure to the plastic during passaging ...
-
bioRxiv - Bioengineering 2021Quote: ... For transfection in 2.0 mL 96-well deep well blocks (Genesee Scientific, El Cajon, CA), 0.8 mL of cells at 6 × 106 cells/mL were plated on the day of transfection ...
-
bioRxiv - Immunology 2020Quote: All immunoprecipitation experiments were conducted in 2 ml deep-well polypropylene plates (Genesee Scientific, Inc). Plates were blocked with 3% BSA in TBST overnight with overhead rotation on a Rotator Genie prior to use for immunoprecipitations ...
-
bioRxiv - Genetics 2019Quote: ... Large numbers of Drosophila embryos were staged and collected on grape juice agar plates that were fitted into embryo collection cages (Genesee Scientific, FS59-100) following the started protocol ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... eggs were cleaned and isolated in Corning Netwells inserts (#3477) and transferred onto 100 x 15 mm petri dishes with Nutri-Fly media (Genesee Scientific #66-112) prepared using standard protocols ...
-
bioRxiv - Microbiology 2022Quote: ... the growth medium was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA, USA). Expi293 cells were maintained in Expi293TM Expression Medium (Life Technologies Corporation ...
-
bioRxiv - Biochemistry 2023Quote: ... Bulk washed resin could be stored in water at room temperature for several weeks before deployment at which time 100 g was packaged between two layers of Nitex™ nylon mesh (120 µm, Genesee Scientific, El Cajon, CA) and framed within a 30 cm wooden embroidery hoop (Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... Larval crawling media were prepared by pouring 10 ml of melted (1.2%) agarose (Genesee Scientific #20-102GP) into 10 cm petri-dishes (Genesee Scientific #32-107) ...
-
bioRxiv - Cell Biology 2023Quote: ... 270 mg total protein was divided evenly into 11 5-mL centrifuge tubes (Genesee Scientific, 24-285) and rotated with FLAG antibody overnight at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... Droplets were collected at ∼3750 droplets/sec for 30 minutes in 50 mL tubes (Genesee Scientific, #28-106).
-
bioRxiv - Biochemistry 2023Quote: ... Disks for 50 ml RNase-free plastic tubes (part number 28-106, Genesee Scientific, San Diego Ca, USA) were cut to 28.8mm dia ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated at room temperature for 30 minutes in a 2.0 mL screw cap tube (Genesee # 21-265), vortexing every 5 minutes for 15-second pulses ...
-
bioRxiv - Cell Biology 2023Quote: ... we removed 5 mL of supernatant and filtered it through 0.45 µm PES syringe filters (Genesee Scientific, #25-246) and stored the filtrate at 4 °C ...
-
bioRxiv - Genetics 2023Quote: ... flies were put on grape agar plates (Grape Agar Powder Premix diluted in 380 mL tap water, Flystuff, Genesee Scientific) supplemented with yeast paste (dry yeast from Saccharomyces cerevisiae resuspended in tap water) ...
-
bioRxiv - Microbiology 2023Quote: ... The growth medium for HEK 293T/17 cells was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse emulsions droplets were generated at ∼2000 drops/sec and collected in two batches of 15 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Genomics 2019Quote: ... Reverse emulsions droplets were generated at ∼3000 drops/sec and collected in two batches of 20 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Microbiology 2023Quote: ... bleach was removed by vacuum filtration of eggs through 1000 mL of diH2O and a 0.22 μm filter (Genesee Scientific, San Diego, CA). Eggs were then washed twice in 70% ethanol and allowed to dry ...
-
bioRxiv - Genetics 2023Quote: ... Flies were expanded in vials (23 mm X 95 mm) containing ∼ 5 mL of a standard cornmeal-based medium for larval growth (Genesee Scientific, Cat#: 66-113) adapted from the Bloomington Drosophila Stock Center (https://bdsc.indiana.edu) ...
-
bioRxiv - Microbiology 2023Quote: ... brucei Lister 427 were grown in 5 ml of modified HMI-9 medium46 in T25 suspension cell culture flasks (Genesee Scientific, Cat. No. 25-213) under a humidified atmosphere of 5% CO2 at 37 °C ...