Labshake search
Citations for Genesee Scientific :
51 - 100 of 132 citations for 2'3' cyclic GAMP cGAMP ELISA Kit 384 well Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Clonal lines were produced via dilution by plating 0.5 cells per 48-well plate (Genesee Scientific, Morrisville, NC) and visual confirmation of single-cell deposition ...
-
bioRxiv - Developmental Biology 2020Quote: ... iPS cells were dissociated into a single cell suspension and plated in a 96-well U-bottom plate (Genesee Scientific) at 3,000 cells per well in APEL2 (StemCell Technologies ...
-
bioRxiv - Developmental Biology 2019Quote: ... cDNA amplification was performed on 75,000 RNA-DNA barcode bead conjugates in a 96-well plate (Genesee Scientific, #24-302) loaded at 5000 beads per well ...
-
bioRxiv - Genomics 2019Quote: ... cDNA amplification was performed on 75,000 RNA-DNA barcode bead conjugates in a 96-well plate (Genesee Scientific, #24-302) loaded at 5000 beads per well ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were then diluted 10-fold with TSB supplemented with 2.5% of a carbon source in a 6-well cell culture plate (Genesee Scientific). The plate was overlaid with two AeraSeal sealing membranes (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... NIH 3T3s were transfected at 50–75% confluence in 6-well tissue culture plates (25-105; Genesee Scientific, El Cajon, CA) using Lipofectamine 2000 (11668019 ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μL of this culture was diluted into 200 μL of M9 medium contained in an untreated 96 well plate (Genesee Scientific). The medium was overlaid with 70 μL of mineral oil ...
-
bioRxiv - Genomics 2021Quote: ... cDNA amplification was performed on RNA-DNA conjugates attached to ∼120,000 barcode beads in a 96-well plate (Genesee Scientific, #24-302) loaded at 10,000 STAMPs per well ...
-
bioRxiv - Genetics 2024Quote: ... Flies are then maintained on an egg laying medium with a layer of wet yeast on top in 48-well cell culture plates (Genesee Scientific, 25-103) for a 24-hour “pre-egg laying period.” This provides time for the small cohorts of flies in each well to become accustomed to the new environment and receive a uniform nutritional experience before the fecundity measurements begin.
-
bioRxiv - Developmental Biology 2024Quote: ... Subsequently, the cortical cells were plated in microfluidic axon isolation silicon device (Xona Microfluidics, #snd150) or 12-well plates (Genesee Scientific, #25-106) pre-coated with neuron coating solution I (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... For transfection in 2.0 mL 96-well deep well blocks (Genesee Scientific, El Cajon, CA), 0.8 mL of cells at 6 × 106 cells/mL were plated on the day of transfection ...
-
bioRxiv - Microbiology 2024Quote: ... and antibiotics (where indicated) was placed in the wells of an untreated 96 well microplate (Genesee Scientific). An overnight culture was washed once in dH2O and diluted either 1000-fold (high density ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 6-well pates (Genesee Scientific, San Diego, CA), or μ-dishes or μ-slide chambers (ibidi ...
-
bioRxiv - Microbiology 2022Quote: Experiments were conducted using six-well microplates (Genesee Scientific) added with THY containing a 2% suspension of washed sheep erythrocytes ...
-
bioRxiv - Neuroscience 2024Quote: ... PSCs were cultured on 6 cm treated plates (Genesee Scientific) until they reached about 75% confluence ...
-
bioRxiv - Immunology 2020Quote: ... plates were sealed with a rubber sealing mat (Genesee Scientific, Inc) and rotated overhead overnight on a Rotator Genie ...
-
bioRxiv - Genomics 2020Quote: ... pH adjusted to 5.8 with KOH) in large petri plates (Genesee Scientific). Following a 4 day vernalization period in water ...
-
bioRxiv - Biochemistry 2021Quote: Cells were plated in 24-well clear tissue culture-treated (Genesee Scientific, San Diego) plates and compounds were pre-treated as stated for 16 h ...
-
bioRxiv - Cell Biology 2023Quote: ... Small liquid cultures were maintained in polystyrene tissue culture plates (Genesee Scientific, USA). For strain maintenance ...
-
bioRxiv - Microbiology 2022Quote: Hydrogen peroxide production was quantified from bacterial cultures inoculated in six-well microplates (Genesee Scientific) that had been added with THY ...
-
Expansion of apical extracellular matrix underlies the morphogenesis of a recently evolved structurebioRxiv - Developmental Biology 2019Quote: ... Dumpy:YFP flies were grown in egg-laying chamber with grape agar plates (Genesee Scientific). Embryos were removed from plates using forceps and rolled on a piece of double sided tape to remove the chorion ...
-
bioRxiv - Developmental Biology 2021Quote: ... The developmental timing was synchronized by staging egg-laying on grape agar plates (Genesee Scientific) during a designated 4-hour interval ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments were conducted on assay plates (100 × 15 mm, Genesee Scientific, Cat. No: 32-107) filled with a thin layer of 2.5% agarose containing either pure agarose (EMSCO/Fisher ...
-
bioRxiv - Developmental Biology 2020Quote: ... with collection from a 4-hour egg-laying interval on grape agar plates (Genesee Scientific) with a small amount of baker’s yeast paste ...
-
bioRxiv - Biochemistry 2023Quote: ... cells at ∼80% confluency (10-cm plates) were first washed with DPBS (Genesee 25-508), then trypsinized and pelleted by centrifugation at 200 x g for 5 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Experiments were conducted on assay plates (100 × 15 mm, Genesee Scientific, Cat. No: 32-107) filled with a thin layer of 2.5% agarose containing either pure agarose (EMSCO/Fisher ...
-
bioRxiv - Cell Biology 2019Quote: ... Experiments were successfully performed in both plastic 24-well flat bottom dishes (Olympus Plastics, Genesee Scientific, Cat. # 25-107) and 9-well spot plates (Corning Glass ...
-
bioRxiv - Cell Biology 2022Quote: HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Biophysics 2022Quote: HeLa cells were cultured in 5% CO2 on cell culture-treated 10 cm plates (Genesee Scientific, 25-202) in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and seeding of 2.0 x 106 cells on a 10 cm tissue culture plate (Genesee Scientific, #25-202).
-
bioRxiv - Evolutionary Biology 2021Quote: ... We obtained all flies by collecting eggs on yeasted grape juice agar plates (FlyStuff grape agar premix, Genesee Scientific) from stock populations ...
-
bioRxiv - Molecular Biology 2024Quote: ... Zymo Research Kit (Genesee: 11-328). RNA concentration was measured using the Nanodrop1000 spectrophotometer (Thermo Fisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant from the HCoV-OC43 treatment plates was serially diluted in 1x PBS supplemented with calcium and magnesium (Genesee Scientific) containing 0.2% BSA (Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... flies were put on grape agar plates (Grape Agar Powder Premix diluted in 380 mL tap water, Flystuff, Genesee Scientific) supplemented with yeast paste (dry yeast from Saccharomyces cerevisiae resuspended in tap water) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... The supernatant from the GO-AgNP treatment plates was serially diluted in 1x PBS supplemented with calcium and magnesium (Genesee Scientific) containing 0.2% BSA (Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Direct-zol™ RNA MiniPrep Kit (Genesee Scientific/Zymo Research ...
-
bioRxiv - Genetics 2020Quote: ... were crossed with male X-linked mChFP-Rho1 flies in cages and allowed to lay eggs on a grape agar plate (Genesee Scientific. Inc). The germ cells of the female progeny will carry both GFP and mChFP fluorescence ...
-
bioRxiv - Microbiology 2023Quote: ... This method involved plating 10 μL of six dilutions on separate tracks of a single square plate (Genesee Scientific, Cat # 26-275). All plates were incubated at 37°C for 24 hr anaerobically ...
-
bioRxiv - Developmental Biology 2019Quote: ... or Direct-zol RNA Miniprep Kit (Genesee Scientific), and RNA was reverse-transcribed by Superscript IV (Invitrogen ...
-
bioRxiv - Genetics 2019Quote: ... Large numbers of Drosophila embryos were staged and collected on grape juice agar plates that were fitted into embryo collection cages (Genesee Scientific, FS59-100) following the started protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... and purified using Zymo ChIP DNA Concentrator kit (Genesee Scientific #11-379C ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using the RNeasy kit (Genesee Scientific, USA) following manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... Zymo DNA clean and concentrator kit (D4004) was from Genesee Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid DNA was purified using Zyppy Plasmid Miniprep Kit (Genesee Scientific) and sequenced using primers as followed ...
-
bioRxiv - Microbiology 2022Quote: ... and genomic DNA was extracted using the Quick-DNA Miniprep Kit (Genesee) or the DNeasy Blood & Tissue Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was isolated using Quick-RNA MiniPrep Kit (Genesee Scientific: 11-328). When necessary ...
-
bioRxiv - Biochemistry 2019Quote: ... and gel-purified with ZymoClean Gel DNA Recovery Kit (Genesee Scientific, #11-300C) to produce the final library ...