Labshake search
Citations for Genesee Scientific :
151 - 196 of 196 citations for 1 2 Bis Pentabromophenyl Ethane Unlabeled 25 Ug Ml In Toluene since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... AMB-1 stock cultures were grown as described by picking single colonies and growing in 1.5 mL Magnetospirillum Growth (MG) medium in 1.7 mL microtubes (Genesee Scientific Cat #24-281) at 30 °C for 3-4 d with 15 µl Wolfe’s vitamin solution and 20 µM ferric malate (48) ...
-
bioRxiv - Cell Biology 2019Quote: ... and 2 × 105 recipient cells/well (A549) in 6-well plates (Genesee Scientific) were reverse transfected with 5 nM siRNA using Lipofectamine RNAiMAX (ThermoFisher) ...
-
bioRxiv - Neuroscience 2022Quote: ... Tegosept (79.55 ml, Genesee Scientific, San Diego, CA, USA), were added ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 ml/L 1M Propionic Acid (Genesee Scientific, cat. #789177), 15 ml/L 10 % w/v Tegosept in Et-OH 96 % (Genesee Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 μg/ml streptomycin (Genesee Scientific, San Diego, CA, USA) at 37°C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Cell Biology 2023Quote: ... and 100 µg/mL streptomycin (Genesee Scientific, El Cajon, CA) at 37 °C with 5% CO2 in a humidified incubator ...
-
bioRxiv - Biochemistry 2023Quote: 50 ml serological (Genesee Scientific, USA; cat. no. 12-107)
-
bioRxiv - Biochemistry 2023Quote: 5 ml serological (Genesee Scientific, USA; cat. no. 12-102)
-
bioRxiv - Biochemistry 2023Quote: 10 ml serological (Genesee Scientific, USA; cat. no. 12-104)
-
bioRxiv - Genetics 2023Quote: ... 79.7 mL/L molasses (Flystuff Genesee Scientific, San Diego CA), 35.9 g/L yeast (Genesee Scientific ...
-
bioRxiv - Genetics 2024Quote: ... at 0.2 g/ml and agarose powder (Genesee Scientific, 20101) at 0.02 g/ml ...
-
bioRxiv - Genomics 2021Quote: ... reactions were set up in 10 μl volumes with: 5 μl 2×Apex PCR Master Mix (Genesee Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... for 2 h and then filtered using a vacuum-driven 0.22 µm filter (Olympus plastics, Genesee Scientific) prior to the inoculation of cells to remove any remaining trace of metal ...
-
bioRxiv - Developmental Biology 2022Quote: ... An equal amount (15 ml) of fly food medium (Molasses Formulation, Genesee Scientific) was used in each vial.
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 1% FBS (Genesee), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Biophysics 2021Quote: ... and the cleared supernatant was applied to a 5 ml Ni2+ column (Genesee or Cytivia) and eluted with a 15 column volume gradient from 0-100% Ni2+ B buffer (Buffer A plus 250 mM imidazole) ...
-
bioRxiv - Cell Biology 2022Quote: ... 15 ml/L 10 % w/v Tegosept in Et-OH 96 % (Genesee Scientific, cat. #789063) per liter ...
-
bioRxiv - Biophysics 2020Quote: ... the growth medium was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA). INS-1E cells were obtained from Addexbio Technologies (San Diego ...
-
bioRxiv - Neuroscience 2021Quote: ... passaging NSCs in conical tubes manufactured by Genesee (15 mL conical tubes, Cat#28-103) resulted in death of the NSC cultures within 1 week of brief exposure to the plastic during passaging ...
-
bioRxiv - Bioengineering 2021Quote: ... For transfection in 2.0 mL 96-well deep well blocks (Genesee Scientific, El Cajon, CA), 0.8 mL of cells at 6 × 106 cells/mL were plated on the day of transfection ...
-
bioRxiv - Microbiology 2022Quote: ... the growth medium was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA, USA). Expi293 cells were maintained in Expi293TM Expression Medium (Life Technologies Corporation ...
-
bioRxiv - Cell Biology 2020Quote: sgRNA transduced cells seeded on 6-well plates at ~60% confluency were transfected with 2 μg flag-tagged β2-AR for 48 hr using JetPrime Transfection reagent (Genesee, Cat #55134) following manufacturer’s protocols ...
-
bioRxiv - Neuroscience 2019Quote: ... Larval crawling media were prepared by pouring 10 ml of melted (1.2%) agarose (Genesee Scientific #20-102GP) into 10 cm petri-dishes (Genesee Scientific #32-107) ...
-
bioRxiv - Cell Biology 2023Quote: ... 270 mg total protein was divided evenly into 11 5-mL centrifuge tubes (Genesee Scientific, 24-285) and rotated with FLAG antibody overnight at 4 °C ...
-
bioRxiv - Genomics 2021Quote: ... Droplets were collected at ∼3750 droplets/sec for 30 minutes in 50 mL tubes (Genesee Scientific, #28-106).
-
bioRxiv - Biochemistry 2023Quote: ... Disks for 50 ml RNase-free plastic tubes (part number 28-106, Genesee Scientific, San Diego Ca, USA) were cut to 28.8mm dia ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated at room temperature for 30 minutes in a 2.0 mL screw cap tube (Genesee # 21-265), vortexing every 5 minutes for 15-second pulses ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reactions also contained 1 U APEX Taq (Genesee Scientific), 1 U HotStar Taq (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... flies were put on grape agar plates (Grape Agar Powder Premix diluted in 380 mL tap water, Flystuff, Genesee Scientific) supplemented with yeast paste (dry yeast from Saccharomyces cerevisiae resuspended in tap water) ...
-
bioRxiv - Microbiology 2023Quote: ... The growth medium for HEK 293T/17 cells was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... penicillin/streptomycin (1×, GenClone, Genesee Scientific, El Cahon, CA, USA) and voriconazole (1 mM final concentration ...
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2019Quote: ... Reverse emulsions droplets were generated at ∼2000 drops/sec and collected in two batches of 15 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Genomics 2019Quote: ... Reverse emulsions droplets were generated at ∼3000 drops/sec and collected in two batches of 20 minutes each in 50 mL tubes (Genesee Scientific, #28-106). After collection ...
-
bioRxiv - Microbiology 2023Quote: ... bleach was removed by vacuum filtration of eggs through 1000 mL of diH2O and a 0.22 μm filter (Genesee Scientific, San Diego, CA). Eggs were then washed twice in 70% ethanol and allowed to dry ...
-
bioRxiv - Genetics 2023Quote: ... Flies were expanded in vials (23 mm X 95 mm) containing ∼ 5 mL of a standard cornmeal-based medium for larval growth (Genesee Scientific, Cat#: 66-113) adapted from the Bloomington Drosophila Stock Center (https://bdsc.indiana.edu) ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 hr with OneBlock Western-CL Blocking Buffer (Genesee), and incubated with primary antibodies diluted in OneBlock (Supplementary Table S8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1% agarose was prepared by microwaving 1g/L agarose (Genesee Scientific; 20-102GP) in 1X TAE ...
-
bioRxiv - Molecular Biology 2023Quote: ... with 10% Fetalgro synthetic FBS (RMBio, FGR-BBT) and 1% Penicillin-Streptomycin (Genesee Scientific). HEK cells were transiently cotransfected with pCMV-EGFP and the relevant plasmid of interest in a six well plate using the Lipofectamine3000 protocol (Thermofisher) ...
-
bioRxiv - Cancer Biology 2023Quote: PANC-1 (CRL-1469) cells were obtained from ATCC and grown in DMEM media (Genesee) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was added to one 50 µl aliquot of electrocompetent cells on ice for 5 min before transferring to a 1 mm electroporation cuvette (Genesee Scientific). After electroporation (Eppendorf 2510 ...
-
bioRxiv - Molecular Biology 2022Quote: ... For transmission electron microscopy experiments Human hepatoma (HuH-7) wild type and YBX-1 KO cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Genesee Scientific, San Diego, CA) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2021Quote: ... VA) was purchased and maintained in DMEM-10 (DMEM with 10% fetal bovine serum and 1% penicillin/streptomycin: Genesee Scientific, San Diego, CA). C8-D1A cells were modified to express an inducible CreERT2 protein (known further as C8-D1A-CreERT2 astrocytes ...
-
bioRxiv - Genetics 2021Quote: Flies were grown and maintained on food consisting of the following ingredients: 1 part of Nutri-Fly® GF (Genesee Scientific, cat. 66-115) and 3 parts of Jazz-mix (Fisher Scientific ...