Labshake search
Citations for Genesee Scientific :
101 - 110 of 110 citations for 4 Methoxy 2 2 3 4 5 5 Hexacb Unlabeled 50 Ug Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... Larval crawling media were prepared by pouring 10 ml of melted (1.2%) agarose (Genesee Scientific #20-102GP) into 10 cm petri-dishes (Genesee Scientific #32-107) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were incubated at room temperature for 30 minutes in a 2.0 mL screw cap tube (Genesee # 21-265), vortexing every 5 minutes for 15-second pulses ...
-
bioRxiv - Genetics 2023Quote: ... flies were put on grape agar plates (Grape Agar Powder Premix diluted in 380 mL tap water, Flystuff, Genesee Scientific) supplemented with yeast paste (dry yeast from Saccharomyces cerevisiae resuspended in tap water) ...
-
bioRxiv - Microbiology 2023Quote: ... The growth medium for HEK 293T/17 cells was supplemented with 0.5 mg/ml G418 (Genesee Scientific, San Diego, CA, USA).
-
bioRxiv - Developmental Biology 2019Quote: ... Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles) (31) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: ... for a total of 15 wells and amplified for 15 PCR cycles using template switching.5 Post-PCR cleanup was performed by removing the STAMPs (Single Transcriptome Attached to Micro-Particles5) and pooling the supernatant from the wells together into a single 1.7 mL tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2023Quote: ... bleach was removed by vacuum filtration of eggs through 1000 mL of diH2O and a 0.22 μm filter (Genesee Scientific, San Diego, CA). Eggs were then washed twice in 70% ethanol and allowed to dry ...
-
bioRxiv - Cell Biology 2023Quote: Wild-type and RBM12 KO HEK293 cells stably expressing FLAG-tagged β2-AR were generated by transfecting cells seeded on 6-well plate with the FLAG-β2-AR plasmid for 72 hours prior to selection of stable cells using 100 μg/mL G418 sulfate (Genesee Scientific, Cat. #25-538).