Labshake search
Citations for Genesee Scientific :
651 - 700 of 801 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated using the RNeasy kit (Genesee Scientific, USA) following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Flies were grown and maintained on standard food media (Bloomington Recipe, Genesee Scientific). Flies were maintained in incubators (#DR-36VL ...
-
bioRxiv - Microbiology 2021Quote: ... CFCS was collected by centrifugation at 4,000 x g for 10 min at 4 °C followed by filtration of the supernatant through a 0.45 μm polyethersulfone (PES) filter (Genesee Scientific, San Diego, CA). To eliminate the effects of differences of pH on yeast inhibition ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 30 males and females were selected per test tube (Genesee Scientific, USA) on the nutrient medium with ABE in concentrations 0.1 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and seeding of 2.0 x 106 cells on a 10 cm tissue culture plate (Genesee Scientific, #25-202).
-
bioRxiv - Molecular Biology 2021Quote: ... gDNA was extracted using the YeaStar Genomic DNA Kit (Genesee Scientific, San Diego, CA, Cat #11-323) according to the manufacturer’s “Protocol 1” ...
-
bioRxiv - Genomics 2021Quote: ... topped up with 10% Fetal Bovine Serum (Genesee Scientific, cat: #25-514). Cells were split at a consistent interval of 3 days ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 1% FBS (Genesee), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... and immunodetected using appropriate primary and peroxidase-coupled secondary antibodies (Genesee Scientific). Proteins were visualized by West Pico and West Dura chemiluminescence Substrate (Thermo Fisher).
-
bioRxiv - Cell Biology 2021Quote: ... worms were carefully pipetted with low bind tips (Genesee Scientific, cat no. 23-121RS) to NGM plates ...
-
bioRxiv - Immunology 2021Quote: HEK293T cells were maintained in DMEM medium (Genesee Scientific, #25-501) supplemented with 10% fetal bovine serum (Omega Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... pallida (collected in Berkeley, California, US) were maintained on Nutri-Fly medium (Genesee Scientific). S ...
-
bioRxiv - Cell Biology 2021Quote: ... and Tegosept (Genesee).
-
bioRxiv - Genomics 2021Quote: ... cDNA amplification was performed on RNA-DNA conjugates attached to ∼120,000 barcode beads in a 96-well plate (Genesee Scientific, #24-302) loaded at 10,000 STAMPs per well ...
-
bioRxiv - Genomics 2021Quote: ... Droplets were collected at ∼3750 droplets/sec for 30 minutes in 50 mL tubes (Genesee Scientific, #28-106).
-
bioRxiv - Genomics 2021Quote: ... and SMART PCR primer (AAGCAGTGGTATCAACGCAGAGT).[1] Post-PCR cleanup was performed by removing the STAMPs and pooling the supernatant from the wells together into a single 1.7 mL low-retention tube (Genesee Scientific, #22-281LR) along with 0.6X Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Biochemistry 2021Quote: ... 0.45 µm (Genesee Scientific, Cat. # 25-246)
-
bioRxiv - Biochemistry 2021Quote: ... or using autoradiographic films (Blue Devil, Genesee Scientific) after incubation with peroxidase chemiluminescent substrates (BioRad Clarity ECL for CCD acquisition ...
-
bioRxiv - Biochemistry 2021Quote: ... Plasmid DNA was purified using Zyppy Plasmid Miniprep Kit (Genesee Scientific) and sequenced using primers as followed ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.75 µL of MgCl2 (42-800B3, Apex Bioresearch Products, Genesee Scientific, El Cajon, CA, USA), 1.25 µL of DMSO (D128-500 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.125 µL of Taq (42-800B3, Apex Bioresearch Products, Genesee Scientific, El Cajon, CA, USA), 1.25 µL of forward primer at working concentration ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR reaction reagents included 2.5 µL of 10x Buffer (42-800B3, Apex Bioresearch Products, Genesee Scientific, El Cajon, CA, USA), 0.5 µL of dNTPs (17-106 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.5 µL of dNTPs (17-106, PCR Biosystems, Genesee Scientific, El Cajon, CA, USA), 0.75 µL of MgCl2 (42-800B3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... we collected eggs from the parental generation by leaving them to lay in embryo collection cages (Genesee Scientific) on 90mm petri dishes half-filled with apple juice/agar medium ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and 1X MEM non-essential amino acids (Genesee; catalog# 25-536). To induce expression of transiently transfected plasmids ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2 mM L-glutamine (Genesee, catalog# 25-509) and 1X MEM non-essential amino acids (Genesee ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 1X Pen-Strep (Genesee; catalog# 25-512), 2 mM L-glutamine (Genesee ...
-
bioRxiv - Neuroscience 2021Quote: ... adult Drosophila melanogaster were transferred to collection cages (Genesee Scientific). One side of the cage held a grape juice agar plate and fresh yeast paste ...
-
bioRxiv - Genetics 2021Quote: Flies were grown and maintained on standard Drosophila food media (Bloomington Recipe, Genesee Scientific, San Diego, California) in incubators (Powers Scientific ...
-
bioRxiv - Cell Biology 2021Quote: Schneider’s medium (Genesee Scientific, 25-515) was modified by adding the following reagents to the stated final concentrations ...
-
bioRxiv - Genetics 2021Quote: ... All strains were maintained at 25 °C on Drosophila medium (Nutri-Fly®GF; Genesee Scientific) treated with propionic acid ...
-
bioRxiv - Immunology 2021Quote: ... or JetOptimus (Genesee Scientific) according to manufacturer’s recommended protocols ...
-
bioRxiv - Immunology 2021Quote: ... Tissues were dissociated and strained through 30µm nylon mesh (Genesee Scientific). For purification of DN3/4 thymocytes cells were stained with biotinylated antibodies against B220 ...
-
bioRxiv - Immunology 2021Quote: ... Tissues were then dissociated in FACS Buffer (PBS supplemented with 2.5% FBS and 2mM EDTA) using a Dounce Homogenizer and filtered through 70µm nylon mesh (Genesee Scientific) to yield single-cell suspensions ...
-
bioRxiv - Cancer Biology 2021Quote: ... penicillin/streptomycin (1×, GenClone, Genesee Scientific, El Cahon, CA, USA) and voriconazole (1 mM final concentration ...
-
bioRxiv - Bioengineering 2021Quote: ... For transfection in 2.0 mL 96-well deep well blocks (Genesee Scientific, El Cajon, CA), 0.8 mL of cells at 6 × 106 cells/mL were plated on the day of transfection ...
-
bioRxiv - Molecular Biology 2021Quote: ... Crosses were made in polypropylene vials (Genesee Scientific Cat. #32-120), and all flies were frozen for 48 hours before being removed from the facility ...
-
bioRxiv - Biochemistry 2021Quote: Cells were plated in 24-well clear tissue culture-treated (Genesee Scientific, San Diego) plates and compounds were pre-treated as stated for 16 h ...
-
bioRxiv - Genomics 2021Quote: ... 0.056% w/v tegosept (Genesee Scientific, San Diego CA), and 0.39% v/v propionic acid (Sigma Aldrich)) ...
-
bioRxiv - Genomics 2021Quote: ... 0.5% w/v type II Drosophila agar (Genesee Scientific, San Diego CA), 0.056% w/v tegosept (Genesee Scientific ...
-
bioRxiv - Genetics 2021Quote: ... and tubes were capped with small foam plugs cut from Droso-Plugs (Genesee Scientific, 59-200). Rather the placing the monitor tubes into an automated monitoring system (Najarro et al ...
-
bioRxiv - Genetics 2021Quote: Flies were grown and maintained on food consisting of the following ingredients: 1 part of Nutri-Fly® GF (Genesee Scientific, cat. 66-115) and 3 parts of Jazz-mix (Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We obtained all flies by collecting eggs on yeasted grape juice agar plates (FlyStuff grape agar premix, Genesee Scientific) from stock populations ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 mL cold neutralized collagen solution was added to 6-well tissue culture plates (Genesee 25-105) pre-warmed to 37 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The membrane was blocked overnight at 4°C in OneBlock Western-FL Blocking Buffer (Genesee Scientific), then incubated in the primary antibody at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... The filter was treated with Ponceau red stain and blocked in OneBlock (Genesee Scientific). Proteins were detected using primary antibodies α-FLAG (monoclonal α-FLAG M2 ...
-
bioRxiv - Bioengineering 2021Quote: ... and Penicillin-streptomycin (Genesee scientific, PSL01-100ML) at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... Flies were reared in Wide Drosophila Vials (Cat #: 32-114, Genesee), with Droso-Plugs® (Cat # ...
-
bioRxiv - Immunology 2021Quote: ... Tissues were incubated for 30 minutes at room temperature in DMEM media without phenol red (Genesee Scientific) plus 0.15% DTT (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... One half was homogenized in reduced phosphate-buffered saline (PBS) (Genesee Scientific) and serially diluted and plated directly onto Cullen-Haiser Gut (CHG ...