Labshake search
Citations for Biotek :
351 - 400 of 1405 citations for N 2 Chloro 5 1 oxo 2 3 pentadecylphenoxy butyl amino phenyl 4 4 dimethyl 3 oxovaleramide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Microbiology 2020Quote: ... The optical density (OD) was measured at 492 nm on a Synergy 4 plate reader (BioTek) or equivalents ...
-
bioRxiv - Systems Biology 2021Quote: ... OD was monitored at 600 nm on a Synergy 4 plate reader (BioTek Instruments, Winooski VT) with the continuous shaking setting.
-
bioRxiv - Plant Biology 2021Quote: ... Light scattering at 340 nm was monitored at 45°C in a Synergy 4 spectrophotometer (BioTek) for 90min ...
-
bioRxiv - Immunology 2024Quote: ... was then added to each well and the luminescence was read in a Synergy 4 (BioTek) plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... the rhamnolipid content was quantified at OD420 in a Synergy 4 Multi-Mode Microplate Reader (BioTek). To calculate the concentration of rhamnolipid a standard curve of rhamnose was made from the following concentrations (0 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the plate was incubated for 10 minutes before FP measurements with a BioTek Synergy 4 (BioTek) at excitation and emission wavelengths of 485 and 528 nm ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The measurement was started immediately using either a Synergy 4 multimode microplate reader (BioTek Instruments Inc.) or a SpectraMax iD5 microplate reader (Molecular Devices GmbH) ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was washed 3 times with 300 uL of supplied wash buffer using a microplate washer (Biotek 405TS). 100 µL of enzyme conjugate was added to the wells and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cellular abundance was read out 72 hours later using the Presto Blue assay (Thermo) on a Cytation 3 (BioTek) plate reader ...
-
bioRxiv - Cell Biology 2021Quote: ... and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek) at sequential 30-second intervals ...
-
bioRxiv - Microbiology 2021Quote: ... Viability was quantified by fluorescent measurement (Ex. 560 nm, Em. 590 nm) in a Cytation 3 microplate reader (Biotek). Fluorescence values were normalized to DMSO (100% viability ...
-
bioRxiv - Biochemistry 2023Quote: ... Absorbance at 412 nm (A412) was measured every minute for 30 minutes on a Cytation 3 plate reader (BioTek).
-
bioRxiv - Neuroscience 2023Quote: ... The cells were imaged for GFP fluorescence using an automated Cytation 3 Cell Imaging Reader (BioTek Instruments, Winooski, VT) equipped with a 4x objective ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA in an ODE sample was measured using NanoDrop (Biotek synergy 2). Then RNA concentration was used as a criterion for the amount of DNase (Turbo Dnase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescence was detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2020Quote: Growth curves were obtained using an Epoch 2 Microplate Spectrophotometer (Biotek Instruments, Vermont). The plate reader went through 15-min cycles of incubation at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). In vitro growth assays were performed in triplicate with different colonies.
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). Similarly ...
-
bioRxiv - Genomics 2022Quote: ... Growth studies were conducted with the BioTek Synergy™2 system (BioTek Instruments) at 37°C with slow shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence intensities were monitored continuously during substrate hydrolysis on Synergy 2 (BioTek®) plate reader for 120 minutes.
-
bioRxiv - Microbiology 2021Quote: Optical density (OD) measurements were performed with an Epoch 2 plate reader (BioTek) at 37 °C with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Microbiology 2023Quote: ... which was recorded over time with an Epoch 2 Microplate Spectrophotometer (BioTek Instruments). All reactions were performed in triplicates of 60 µl each at 25°C in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The luminescence signal was then measured using a Synergy 2 plate reader (Biotek) according to the manufacturer’s guidelines.e
-
bioRxiv - Biochemistry 2023Quote: ... the fluorescence intensity was measured using a Synergy 2 multimode microplate reader (BioTek) at excitation and emission wavelengths of 360 and 460 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plates were read at 450 nm in a Syngery 2 Plate reader (BioTek).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and grown at 28°C in an Epoch 2 Microplate Spectrophotometer (Agilent BioTek). Absorbance at 600nm (OD600 ...
-
bioRxiv - Microbiology 2022Quote: ... Incubation and OD measurements were performed with an Epoch 2 plate reader (BioTek) at appropriate temperatures with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance at 600 nm was determined using a Synergy 2 plate reader (BioTek).
-
bioRxiv - Cancer Biology 2024Quote: ... and luminescence detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring A600 every 15min (Epoch 2 or SynergyMx, (Biotek) plate readers) ...
-
bioRxiv - Biochemistry 2024Quote: Peroxidase activity assays were carried out using a Synergy 2 microplate reader (BioTek) at room temperature by following the rate of oxidation of 2,2′-azino bis (3-ethylbenzthiazoline-6-sulfonic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... data acquisition was obtained using a microplate spectrophotometer (Epoch 2; BioTek, Winooski, USA) at wavelengths of 450Lnm ...
-
bioRxiv - Immunology 2022Quote: ... the plates were washed 4 times with 0.05% Tween 1xPBS (PBST) solution using a plate washer (BioTek). Secondary antibodies (anti-Flag-HRP or anti-Human Fc-HRP ...
-
bioRxiv - Bioengineering 2020Quote: ... After 4 h of incubation the viability was assessed using fluorescent plate reader (Synergy HTX, Biotek, USA) at wavelengths of 540 nm excitation and 590 nm emission ...
-
bioRxiv - Molecular Biology 2020Quote: ... and fluorescence was measured 4 h-post addition using a Synergy HTX Multi-mode plate reader (BioTek). The metabolically active cells convert the blue redox reagent into its fluorescent product with the number of live cells directly proportional to the intensity of the fluorescent product ...
-
bioRxiv - Pathology 2021Quote: ... OD600 was measured every hour for 24 hours in a BioTek Synergy 4 microplate reader (BioTek-Agilent). In vitro growth graphs were generated using ggplot2 and ggprism ...
-
bioRxiv - Bioengineering 2022Quote: ... The absorbance (optical density) was read at 430 nm on the spectrophotometer (Biotek Synergy 4-plate reader). A standard curve of the absorbance of the serially diluted standards from 1.4 mg/ml to 50 ng/ml was used to calculate the sample concentrations ...
-
bioRxiv - Bioengineering 2024Quote: ... Approximately 20 ug of protein from each sample was resolved on a 4-20% gradient gel (Biotek), then visualized by SimplyBlue SafeStain.
-
bioRxiv - Molecular Biology 2024Quote: Fluorescence polarization (FP) method was used to measure the binding affinity with Synergy 4 Microplate Reader (BioTek). Aliquots (5 nM ...
-
bioRxiv - Immunology 2023Quote: ... Blank corrected samples and standard values were plotted using the 4-Parameter logistic model (Gen5 v3.09, BioTek).
-
bioRxiv - Cell Biology 2020Quote: Coelentrazine at a final concentration of 3 μM added per well immediately before reading on a bioluminescence plate reader (Neo2, Biotek) with an integration time of 0.1 s ...
-
bioRxiv - Cancer Biology 2020Quote: ... was added to each well and cells lysed for 10 minutes prior to assessment of absorbance with a Cytation 3 spectrophotometer (BioTek).
-
bioRxiv - Biochemistry 2021Quote: The UV-Vis absorption spectra of the solutions were measured in the beginning of the experiment using either a Cy-tation 3 cell imaging multi-mode reader (BioTek) on a Take3 plate with a 0.5 mm optical path length (2 mM and 200 μM samples) ...