Labshake search
Citations for Biotek :
301 - 350 of 917 citations for Perfluoro 2 oxo 3 6 dimethyl 1 4 dioxane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... The cells with Alamar Blue were further incubated at 37°C for 6 hours, and the fluorescence intensity (excitation 560 nm, emission 590 nm) was measured using Synergy H1 microplate reader (BioTek Instruments, Inc., VA). The fluorescence readings were analysed to determine cell viability ...
-
bioRxiv - Neuroscience 2021Quote: ... Imaging and analysis were performed on a Cytation 3 Cell Imaging Multi-Mode Reader (Biotek, Winooski, VT, U.S.A). Data acquisition and processing was accomplished with Gen 5 software package (Biotek).
-
bioRxiv - Developmental Biology 2022Quote: ... Automated cell counting was conducted using the Cytation 3 and Cytation 5 Cell Imaging Multi-Mode Readers (Biotek).
-
bioRxiv - Immunology 2021Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Microscopic images were acquired at 4x magnification using a Cytation 3 Image reader (BioTek Instruments Inc, Winooski, VT) in TIFF format ...
-
bioRxiv - Bioengineering 2022Quote: ... The absorbance was measured using a plate reader (Cytation 3 microplate reader, BioTek Instruments Inc, Winooski, VT, USA). The corrected absorbance at 490 nm was plotted versus the concentrations of the drugs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fluorescence was read at 485/530 nm and at 530/590 nm in a Cytation™ 3 (BioTek) multifunctional microplate reader ...
-
bioRxiv - Microbiology 2024Quote: ... GFP-positive cells were automatically counted 22 h post-infection by using Cytation 3 microplate reader (BioTek Instruments).
-
bioRxiv - Microbiology 2024Quote: ... Images of TC-tr minigenome rescue events were then immediately captured on a Cytation 3 plate reader (BioTek) using the blue and red channels ...
-
bioRxiv - Cell Biology 2024Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Microbiology 2024Quote: ... with images captured from a fixed location using the Cytation 3 Cell Imaging Multi-Mode Reader (BioTek, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed (80 μl) 3 times with PBS by using the Washer Dispenser EL 406 from Biotek. Cells were permeabilized with Blocking Buffer (PBS pH 7.5 ...
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Microbiology 2020Quote: ... The optical density (OD) was measured at 492 nm on a Synergy 4 plate reader (BioTek) or equivalents ...
-
bioRxiv - Systems Biology 2021Quote: ... OD was monitored at 600 nm on a Synergy 4 plate reader (BioTek Instruments, Winooski VT) with the continuous shaking setting.
-
bioRxiv - Plant Biology 2021Quote: ... Light scattering at 340 nm was monitored at 45°C in a Synergy 4 spectrophotometer (BioTek) for 90min ...
-
bioRxiv - Immunology 2024Quote: ... was then added to each well and the luminescence was read in a Synergy 4 (BioTek) plate reader ...
-
bioRxiv - Microbiology 2023Quote: ... the rhamnolipid content was quantified at OD420 in a Synergy 4 Multi-Mode Microplate Reader (BioTek). To calculate the concentration of rhamnolipid a standard curve of rhamnose was made from the following concentrations (0 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... the plate was incubated for 10 minutes before FP measurements with a BioTek Synergy 4 (BioTek) at excitation and emission wavelengths of 485 and 528 nm ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The measurement was started immediately using either a Synergy 4 multimode microplate reader (BioTek Instruments Inc.) or a SpectraMax iD5 microplate reader (Molecular Devices GmbH) ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was washed 3 times with 300 uL of supplied wash buffer using a microplate washer (Biotek 405TS). 100 µL of enzyme conjugate was added to the wells and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cellular abundance was read out 72 hours later using the Presto Blue assay (Thermo) on a Cytation 3 (BioTek) plate reader ...
-
bioRxiv - Cell Biology 2021Quote: ... and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek) at sequential 30-second intervals ...
-
bioRxiv - Microbiology 2022Quote: ... The quality and yield of RNA were analyzed by the Take-3 Plate and Cytation 5 plate reader (BioTek). For the elimination of genomic DNA contamination ...
-
bioRxiv - Microbiology 2021Quote: ... Viability was quantified by fluorescent measurement (Ex. 560 nm, Em. 590 nm) in a Cytation 3 microplate reader (Biotek). Fluorescence values were normalized to DMSO (100% viability ...