Labshake search
Citations for Biotek :
301 - 350 of 807 citations for 3 1 3 Dioxan 2 yl 3' methoxypropiophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... Growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... measuring OD600 (Epoch 2 microplate spectrophotometer, Biotek Instruments, Winooski, VT, USA) until stationary phase was reached ...
-
bioRxiv - Plant Biology 2021Quote: ... ROS production was measured using a Synergy 2 microplate reader (BioTek).
-
bioRxiv - Molecular Biology 2021Quote: ... and OD492 was measured with a Synergy 2 plate reader (BioTek). Evaluation of unknown supernatant samples by interpolation from standard curves of ConM and ConS reference material was performed using the Gen5 Microplate Reader and Imager Software package ...
-
bioRxiv - Microbiology 2022Quote: ... OD600 values were measured in a microplate reader (Biotek Synergy 2). After background subtraction ...
-
bioRxiv - Cell Biology 2022Quote: ... both assays were measured with a plate reader (BioTek, Synergy 2) at a 570 nm wavelength ...
-
bioRxiv - Immunology 2021Quote: ... Plates were read using an Epoch 2 microplate reader (Biotek, USA) at 450 nm ...
-
bioRxiv - Microbiology 2020Quote: ... and were incubated in a Synergy™ 2 (Biotek, United States) plate reader at 30°C or 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescent signal was quantified using a Synergy 2 Microplate Reader (Biotek, Winooski ...
-
bioRxiv - Immunology 2020Quote: ... Chemiluminescence was measured using a microplate luminescence reader (BioTek, Synergy 2).
-
bioRxiv - Biophysics 2020Quote: ... and growth was monitored using Epoch 2 Microplate Spectrophotometer reader (BioTek) with the following settings ...
-
bioRxiv - Microbiology 2020Quote: Growth curves were performed with a Synergy 2 plate reader (BioTek) to measure OD600 and GFP fluorescence (Ex485/Em528) ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluorescence intensity was recorded on a Synergy 2 plate reader (BioTek) at ex/em wavelengths of 360 nm/440 nm.
-
bioRxiv - Microbiology 2022Quote: ... was analyzed using a Synergy 2 Multi Mode microplate reader (BioTek).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... SEAP levels were subsequently measured using Synergy 2 microplate reader (Biotek) at 620 nm in absorbance mode ...
-
bioRxiv - Plant Biology 2024Quote: Absorption spectra were recorded in a Synergy 2 microplate reader (BioTek) using UV-Star flat bottom 96 well microplates (Grenier Bio-One ...
-
bioRxiv - Zoology 2024Quote: ... A Synergy 2 Multi-Mode Microplate Reader (BioTek, Winooski, VT, USA) was used to measure the absorbance of each well at 450 nm.
-
bioRxiv - Microbiology 2024Quote: ... Growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2023Quote: ... The stacker was coupled to a Synergy 2 plate reader (BioTek), which read OD and shook the plates for 5 min as often as allowed by the plate reader (~1 h).
-
bioRxiv - Plant Biology 2023Quote: ... ROS production was measured using a Synergy 2 microplate reader (BioTek).
-
bioRxiv - Bioengineering 2023Quote: ... on a fluorescence microplate reader (Biotek Synergy 2 plate reader, USA). dsDNA content was calculated using the standard calibration curve ...
-
bioRxiv - Molecular Biology 2023Quote: ... Growth was measured using the Epoch 2 Microplate Spectrophotometer (BioTek Instruments) set to 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The measurements were performed using a Synergy 2 plate reader (BioTek) with excitation and emission wavelengths of 440nm and 680nm respectively.
-
bioRxiv - Microbiology 2023Quote: ... Growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37 °C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... OD450 was read on a standard plate reader (BioTek Synergy 2) and sample 5-mC content was calculated from a standard curve.
-
bioRxiv - Microbiology 2024Quote: ... and OD600 was monitored by a Synergy 2 microplate reader (BioTek). Data was analyzed using Python and plotted with Matplotlib55.
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).