Labshake search
Citations for Biotek :
251 - 300 of 981 citations for 2 Triisopropylsilyl Oxazole 5 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... The GFP positive cells were then counted using Cytation 5 (Biotek, Winooski, VT) with Gen5.5 Software ...
-
bioRxiv - Microbiology 2020Quote: ... Readout was performed on a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek).
-
bioRxiv - Cancer Biology 2020Quote: ... Image analysis was done using Gen 5 Prime v 3.08 software (Biotek Instruments). Flow cytometry data and microscope pictures shown are representative of at least two separate determinations.
-
bioRxiv - Biophysics 2022Quote: All experiments were performed using a Cytation 5 Imaging Reader plate reader (BioTek) with a 96-well plate ...
-
bioRxiv - Microbiology 2021Quote: ... Fluorescence of each plate was read using a Cytation 5 imaging reader (BioTek) and GEN5 software ...
-
bioRxiv - Cancer Biology 2020Quote: ... Fluorescence images were acquired on a Cytation 5 Cell Imager (Biotek, Winooski, VT).
-
bioRxiv - Synthetic Biology 2020Quote: ... and the luminescence was measured immediately using a Cytation 5 plate reader (BioTek). The top 2% variants with bright bioluminescence and large intensity decrease (> 60% decrease ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Imaging was carried out on the Cytation 5 Cell Imaging Multimode reader (BioTek). Three images per field (Brightfield ...
-
bioRxiv - Bioengineering 2021Quote: ... The bioluminescence was recorded by a microplate reader (Fisher Scientific BioTek Cytation 5) with an exposure of 200 milliseconds ...
-
bioRxiv - Bioengineering 2021Quote: ... The bioluminescence was recorded by a microplate reader (Fisher Scientific BioTek Cytation 5) with an exposure of 200 milliseconds ...
-
bioRxiv - Bioengineering 2021Quote: ... Then it was put into a microplate reader (Fisher Scientific BioTek Cytation 5) and the plate was gently shaken for 1 minute before measuring the absorbance at 450 nm ...
-
bioRxiv - Immunology 2021Quote: ... Absorbance (OD, 560 nm) was measured in a microplate reader (Cytation 5, BioTek). Sensitivity to single drug treatments was evaluated by IC50 (4-parameters calculation upon log-scaled doses) ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were imaged using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) at 20× magnification using the automated imaging function to capture 50 non-overlapping images per well ...
-
bioRxiv - Immunology 2022Quote: ... Plates were read at 490 nm on a Cytation 5 microplate reader (BioTek). Analysis was performed using GraphPad Prism 9.3.1 software ...
-
bioRxiv - Synthetic Biology 2024Quote: Incubate for 3 h and 5 min in a plate reader (Biotek Neo2SM).
-
bioRxiv - Synthetic Biology 2024Quote: Incubate for 3 h and 5 min in a plate reader (Biotek Neo2SM).
-
bioRxiv - Immunology 2023Quote: ... Live cell imaging was performed using Citation 5 paired with BioSpa (Biotek/Agilent). Data analysis was achieved with Gen5 software by calculating mCherry MFI ...
-
bioRxiv - Bioengineering 2023Quote: ... Luciferase activity was detected by using a luminescence microplate reader (Cytation 5, BioTek). Neutralizing antibody of selected NHPs was detected as 1:10 dilution at which 50% or less inhibition of the luciferase signal was measured.
-
bioRxiv - Bioengineering 2023Quote: ... and analyzed on the Cytation 5 Gen5 software Image Prime v3.10 (Biotek,USA) using manual mode for phase contrast with LED intensity 8 ...
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Immunology 2022Quote: ... was added for 5 min and plates were analyzed using a plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... according to the manufacturer’s instructions and collecting on a Cytation 5 plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... the absorbance was measured at 490 nm using a plate reader (BioTek Cytation 5).
-
bioRxiv - Biochemistry 2021Quote: ... The resulting signals were ratioed using a Cytation 5 Imaging Reader (BioTek, Winooski, VT). Empty luc2P/Hygro vector served as a negative control.
-
bioRxiv - Cell Biology 2021Quote: ... the fluorescence intensity of AmplexUltraRed was measured with a microplate reader (Cytation 5, BioTek).