Labshake search
Citations for Biotek :
201 - 250 of 919 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Cell Biology 2020Quote: ... The plates were mixed and the fluorescence signal for each well was measured for 1 second at an excitation of 485nm and emission of 535nm using a BioTek microplate reader (BioTek). Growth curves were plotted as the fluorescence values at each time point.
-
bioRxiv - Microbiology 2022Quote: ... Cell nuclei were stained with Hoechst 33342 dye and samples were imaged on a Cytation 1 microscope (Biotek, VT, USA). Images were quantified using CellProfiler 53 ...
-
bioRxiv - Microbiology 2020Quote: ... The change in absorbance at 420 nm was measured every 5 min for 1 hr in a Cytation3 multimode plate reader (BioTek). The relative Vmax for each reaction was calculated using Gen5 software (BioTek) ...
-
bioRxiv - Immunology 2021Quote: ... was added and plates were immediately read kinetically at 405 nm (7 min x 1 min intervals) using plate reader (Biotek). ELISA measurements were recorded as max interval slope and normalized to pooled positive mouse sera included on each plate ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 μg of total RNA (purity/integrity assessed by agarose gel electrophoresis and concentration determined by A260nm using a BioTek Cytation3 microplate reader with a Take3 accessory ...
-
bioRxiv - Microbiology 2020Quote: ... Each well was washed once with 1 mL 1X PBS and RNA was extracted using the EZNA Total RNA kit (Omega Biotek). 375 μL of TRK lysis buffer with β-Mercaptoethanol was added to each well and incubated for 3 minutes at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... The mixture was incubated at room temperature for 1 hr and luminescence was detected with a florescent plate reader (BioTek).
-
bioRxiv - Microbiology 2021Quote: ... Luminescence was measured for 72 h with 1 h intervals with a Synergy Mx Monochromator-Based Multi-Mode Microplate Reader (Biotek) with constant 25°C.
-
bioRxiv - Microbiology 2021Quote: Viral RNA was isolated from clarified cell culture supernatants using an Omega Total RNA Isolation Kit 1 (Omega BioTek, VWR) and reverse transcribed at 42°C using an oligo dT primer and SuperScript II reverse transcriptase (Life Technologies ...
-
bioRxiv - Bioengineering 2022Quote: ... Effluent samples were diluted in a 1:500 ratio and the absorbance was measured with the Synergy Neo Microplate Reader (BioTek) at 450 nm.
-
bioRxiv - Bioengineering 2021Quote: ... Blocked phage supernatants were transferred to blocked microplates and incubated for 1 hr followed by washing with PBST on a plate washer (BioTek). Anti-M13-HRP antibody (Sino Biological ...
-
bioRxiv - Bioengineering 2021Quote: Fluorescence kinetics data of the same circuit at a total volume of 100 uL was collected every 1 min using a microplate reader (Synergy HTX, Multi-Mode reader, Biotek). Excitation (emission ...
-
bioRxiv - Bioengineering 2021Quote: Fluorescence kinetics data of the same circuit at a total volume of 100 uL was collected every 1 min using a microplate reader (Synergy HTX, Multi-Mode reader, Biotek). Excitation (emission ...
-
bioRxiv - Immunology 2022Quote: ... and the cell plate was sat in dark for 1 h before absorbance at 517 nm was recorded using Cytation 5 Cell Imaging Multi-Mode Reader (BioTek). All values were normalized to the background ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA concentration and integrity were determined by electrophoresis on 1% agarose gels containing ethidium bromide and spectrophotometrically using an EPOCH instrument (BioTek). After confirmation ...
-
bioRxiv - Cancer Biology 2020Quote: ... The number of cells was determined at the end of the run using the SRB assay as previously described (62) or in plate cell counting by Cytation 1 imaging reader (Biotek).
-
bioRxiv - Synthetic Biology 2021Quote: 72 hours after transfection cells were harvested and RNA extraction was performed using E.Z.N.A Total RNA Kit 1 (Omega Biotek cat #R6834-01). cDNA generation was performed using SuperScript IV Reverse Transcriptase (Invitrogen) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Luminescence at 485 nm and fluorescent eYFP emission at 530 nm were measured for 1 second per well using a Cytation 5 plate Reader (BioTek). The ratio of eYFP/RLuc was calculated per well and data are presented as percent of dopamine response ...
-
bioRxiv - Immunology 2021Quote: ... after 1-5 minutes of adding TMB and absorbance at 450 nm was measured with a Synergy HTX plate reader (BioTek). Concentrations of antigens were determined using standard curves constructed with purified recombinant proteins and calculated with Gen5 3.02.2 (BioTek).
-
bioRxiv - Immunology 2022Quote: ... Reactions were quenched by addition of 1 N HCl and absorbance at 450 nm were analyzed using a plate reader (BioTek). ELISAs with gp120s and anti-idiotype monoclonal antibodies were performed as above except these proteins were immobilized directly onto high-binding 96-well assay plates (Costar ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were incubated with the reagent for at least 1 minutes prior to reading on Synergy H1 Hybrid Multi-Mode Reader (BioTek) or FLUOstar Omega Microplate Reader (BMG LABTECH) ...
-
bioRxiv - Microbiology 2023Quote: ... 20 µl of 50 µg ml-1 ethidium bromide was added to each well and the absorbance was measured using the SynergyTM Mx microplate reader (BioTek) at 500 nm excitation and 580 nm emission wavelengths for 50 min.
-
bioRxiv - Cell Biology 2023Quote: ... the exact number of nematode in each well was determined on a Cell Imaging Multi-Mode Reader (Cytation 1, BioTek) and was used for normalising/correcting OCR results.
-
bioRxiv - Cancer Biology 2023Quote: ... six wells for each shRNA were stained with 1 μg/mL Hoechst in PBS for 30 minutes and imaged using the Cytation 5 (Biotek) at 4X magnification taking six fields per well ...
-
bioRxiv - Cell Biology 2023Quote: ... The absorbance at 360 nm was measured every 1 min over 45 min at 37°C by using a microplate reader (Synergy H1; BioTek). The detailed protocol was deposited in protocols.io (DOI ...
-
bioRxiv - Physiology 2023Quote: ... the exact number of nematode in each well was determined on a Cell Imaging Multi-Mode Reader (Cytation 1, BioTek) and was used for normalising/correcting OCR results ...
-
bioRxiv - Immunology 2024Quote: ... samples were qualitatively assessed using the Take3 plate on the Cytation 1 cell imaging multi-mode reader with Gen5 software (BioTek). Samples which met established quality guidelines set by the sequencing facility were sent to University of Texas Genomic Sequencing and Analysis Facility for TagSeq library prep and sequencing on NovaSeq with single end ...
-
bioRxiv - Physiology 2023Quote: ... the exact number of nematode in each well was determined on a Cell Imaging Multi-Mode Reader (Cytation 1, BioTek) and was used for normalising/correcting OCR results ...
-
bioRxiv - Microbiology 2022Quote: ... luminescence was quantified with an integration time of 1 s using the Cytation 5 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Cell Biology 2022Quote: ... Scratches were imaged immediately after the addition of CM (0 hours) and after 8 and 24 hours incubation using the automated Cytation 1 Imaging Reader at 4X (BioTek, with Gen5 Version 3.04 software ...
-
bioRxiv - Cancer Biology 2023Quote: ... the reaction was stopped with NaOH (10 μl, 1 M) and absorbance at 410 nm was recorded using Synergy H1 hybrid multi-mode reader (BioTek). The value of each group measured at day 0 was set as 1.
-
bioRxiv - Microbiology 2024Quote: ... OD600 was monitored over time at saturating fluorogen concentrations in 96-well plates using an Agilent Biotek Cytation 1 imaging plate reader driven by Biotek Gen5 (Version 3.12 ...
-
bioRxiv - Immunology 2024Quote: ... and was read at OD405 and recorded in a kinetic assay every minute for 1 hour using a Synergy MX microplate reader (BioTek).
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA in an ODE sample was measured using NanoDrop (Biotek synergy 2). Then RNA concentration was used as a criterion for the amount of DNase (Turbo Dnase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescence was detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2020Quote: Growth curves were obtained using an Epoch 2 Microplate Spectrophotometer (Biotek Instruments, Vermont). The plate reader went through 15-min cycles of incubation at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). In vitro growth assays were performed in triplicate with different colonies.
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). Similarly ...
-
bioRxiv - Genomics 2022Quote: ... Growth studies were conducted with the BioTek Synergy™2 system (BioTek Instruments) at 37°C with slow shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence intensities were monitored continuously during substrate hydrolysis on Synergy 2 (BioTek®) plate reader for 120 minutes.
-
bioRxiv - Microbiology 2021Quote: Optical density (OD) measurements were performed with an Epoch 2 plate reader (BioTek) at 37 °C with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Images were acquired 2 days after transfection with Cytation 5 imaging reader (Biotek) GFP and mCherry channels ...
-
bioRxiv - Genetics 2020Quote: ... Infected cell frequencies were quantified by mNeonGreen at 2 dpi (Cytation 5, BioTek). In parallel ...
-
bioRxiv - Microbiology 2023Quote: ... which was recorded over time with an Epoch 2 Microplate Spectrophotometer (BioTek Instruments). All reactions were performed in triplicates of 60 µl each at 25°C in PBS ...