Labshake search
Citations for Biotek :
201 - 250 of 679 citations for 2 3 Cyclohexenyl Ethyltrimethoxysilane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... and OD600 was monitored by a Synergy 2 microplate reader (BioTek). Data was analyzed using Python and plotted with Matplotlib55.
-
bioRxiv - Neuroscience 2021Quote: ... The absorbance at 450 nm was measured by a microplate reader (Cytation 3, BioTek, Winooski, VT, USA). The dopamine concentrations were determined using a standard curve.
-
bioRxiv - Biochemistry 2021Quote: ... resorufin fluorescence (excitation 530 nm; emission 590 nm) was quantified using a Take-3 plate reader (BioTeK). Experiments were conducted in biological quadruplicate.
-
bioRxiv - Cancer Biology 2020Quote: ... or CellTiterGLO®-based assay followed by luminescence reading by Cytation 3 Cell Imaging Multimode Reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... Images were taken on a cell imaging reader microscopy (Cytation 3 cell imager multi-mode reader; Biotek).
-
bioRxiv - Microbiology 2021Quote: ... The OD600 of the samples was measured every 3 minutes in a Synergy H1 microplate reader (Biotek) at 37 with constant shaking between readings ...
-
bioRxiv - Neuroscience 2023Quote: ... The absorbance was read at 450 nm throughout the plate (Cytation™ 3: BioTek™ Instruments, Inc.).
-
bioRxiv - Immunology 2023Quote: ... The beads were washed with 3 × with 60 μL PBS-T on a plate washer (EL406, Biotek). Secondary antibodies ...
-
bioRxiv - Cancer Biology 2023Quote: ... 48 and 72h of compound incubation at 37°C using a Cytation 3 imaging reader (BioTek®). ZIP (zero interaction potency ...
-
bioRxiv - Molecular Biology 2023Quote: ... cell plates were analyzed for absorbance at 490 nm using a Cytation 3 imaging reader (BioTek Instruments). Data was plotted and analyzed by one-way ANOVA with Tukey’s post-test in GraphPad Prism 9.4.1.
-
bioRxiv - Cell Biology 2023Quote: ... pNA absorbance was measured at 405 nm in Cytation 3 reader (BioTek Instruments Inc., Winooski, VT, USA). A pNA (N2128 ...
-
bioRxiv - Cancer Biology 2023Quote: ... After 3 hours of incubation cell viability was measured using a Synergy H4 hybrid reader (BioTek, USA) using excitation/emission wavelengths of 560nm/590nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... The absorbance was measured at 450 nm using a Cytation 3 plate reader (BioTek, Winooski, VT, USA).
-
bioRxiv - Immunology 2024Quote: ... Plates were incubated at 25°C for 1 h then washed 3× using a plate washer (BioTek). Plates were blocked with 200 μL of 5% non-fat milk in TBST (25 mM Tris (pH 8.0) ...
-
bioRxiv - Molecular Biology 2024Quote: ... resorufin fluorescence (excitation 530 nm; emission 590 nm) was quantified using a Take-3 plate reader (BioTeK). Experiments were conducted in biological triplicate.
-
bioRxiv - Cell Biology 2024Quote: ... After ten minutes the wells were imaged and nuclei counted using a Cytation 3 imaging reader (Biotek).
-
bioRxiv - Molecular Biology 2024Quote: ... resorufin fluorescence (excitation 530 nm; emission 590 nm) was quantified using a Take-3 plate reader (BioTeK). Experiments were conducted in biological triplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... Imaging and analysis were performed on a Cytation 3 Cell Imaging Multi-Mode Reader (Biotek, Winooski, VT, U.S.A). Data acquisition and processing was accomplished with Gen 5 software package (Biotek).
-
bioRxiv - Developmental Biology 2022Quote: ... Automated cell counting was conducted using the Cytation 3 and Cytation 5 Cell Imaging Multi-Mode Readers (Biotek).
-
bioRxiv - Immunology 2021Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Bioengineering 2022Quote: ... The absorbance was measured using a plate reader (Cytation 3 microplate reader, BioTek Instruments Inc, Winooski, VT, USA). The corrected absorbance at 490 nm was plotted versus the concentrations of the drugs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fluorescence was read at 485/530 nm and at 530/590 nm in a Cytation™ 3 (BioTek) multifunctional microplate reader ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Microscopic images were acquired at 4x magnification using a Cytation 3 Image reader (BioTek Instruments Inc, Winooski, VT) in TIFF format ...
-
bioRxiv - Microbiology 2024Quote: ... GFP-positive cells were automatically counted 22 h post-infection by using Cytation 3 microplate reader (BioTek Instruments).
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed (80 μl) 3 times with PBS by using the Washer Dispenser EL 406 from Biotek. Cells were permeabilized with Blocking Buffer (PBS pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: ... Images of TC-tr minigenome rescue events were then immediately captured on a Cytation 3 plate reader (BioTek) using the blue and red channels ...
-
bioRxiv - Cell Biology 2024Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Microbiology 2024Quote: ... with images captured from a fixed location using the Cytation 3 Cell Imaging Multi-Mode Reader (BioTek, USA).
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...