Labshake search
Citations for Biotek :
101 - 150 of 729 citations for trans 2 2 4 Bromophenyl 2 oxoethyl cyclohexane 1 carboxylic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2-4 images at the central callus and distal callus regions were taken using an automatic microscope (Agilent, BioTek Lionheart FX, Santa Clara, CA). Central callus regions were defined as proximal to the fracture site on either side of the bone ...
-
bioRxiv - Microbiology 2024Quote: ... Culture density was recorded as OD600 with a 1 cm pathlength correction using an Epoch 2 plate reader (BioTek) and concentration-response curves were fitted to four parameter Hill equations in GraphPad Prism 10.2.3 (GraphPad Software ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA in an ODE sample was measured using NanoDrop (Biotek synergy 2). Then RNA concentration was used as a criterion for the amount of DNase (Turbo Dnase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescence was detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2020Quote: Growth curves were obtained using an Epoch 2 Microplate Spectrophotometer (Biotek Instruments, Vermont). The plate reader went through 15-min cycles of incubation at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). In vitro growth assays were performed in triplicate with different colonies.
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). Similarly ...
-
bioRxiv - Genomics 2022Quote: ... Growth studies were conducted with the BioTek Synergy™2 system (BioTek Instruments) at 37°C with slow shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence intensities were monitored continuously during substrate hydrolysis on Synergy 2 (BioTek®) plate reader for 120 minutes.
-
bioRxiv - Microbiology 2021Quote: Optical density (OD) measurements were performed with an Epoch 2 plate reader (BioTek) at 37 °C with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Images were acquired 2 days after transfection with Cytation 5 imaging reader (Biotek) GFP and mCherry channels ...
-
bioRxiv - Genetics 2020Quote: ... Infected cell frequencies were quantified by mNeonGreen at 2 dpi (Cytation 5, BioTek). In parallel ...
-
bioRxiv - Microbiology 2023Quote: ... which was recorded over time with an Epoch 2 Microplate Spectrophotometer (BioTek Instruments). All reactions were performed in triplicates of 60 µl each at 25°C in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The luminescence signal was then measured using a Synergy 2 plate reader (Biotek) according to the manufacturer’s guidelines.e
-
bioRxiv - Biochemistry 2023Quote: ... the fluorescence intensity was measured using a Synergy 2 multimode microplate reader (BioTek) at excitation and emission wavelengths of 360 and 460 nm ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plates were read at 450 nm in a Syngery 2 Plate reader (BioTek).
-
bioRxiv - Evolutionary Biology 2023Quote: ... and grown at 28°C in an Epoch 2 Microplate Spectrophotometer (Agilent BioTek). Absorbance at 600nm (OD600 ...
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For all dose-response curves ...
-
bioRxiv - Microbiology 2022Quote: ... Incubation and OD measurements were performed with an Epoch 2 plate reader (BioTek) at appropriate temperatures with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For ATP-independent viability assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance at 600 nm was determined using a Synergy 2 plate reader (BioTek).
-
bioRxiv - Cancer Biology 2024Quote: ... and luminescence detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring A600 every 15min (Epoch 2 or SynergyMx, (Biotek) plate readers) ...