Labshake search
Citations for Biotek :
101 - 150 of 471 citations for Cytosolic arginine sensor for mTORC1 subunit 2 CASTOR2 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA in an ODE sample was measured using NanoDrop (Biotek synergy 2). Then RNA concentration was used as a criterion for the amount of DNase (Turbo Dnase ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescence was detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2020Quote: Growth curves were obtained using an Epoch 2 Microplate Spectrophotometer (Biotek Instruments, Vermont). The plate reader went through 15-min cycles of incubation at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). In vitro growth assays were performed in triplicate with different colonies.
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured after 24 hours using the Epoch 2 plate reader (BioTek). Similarly ...
-
bioRxiv - Genomics 2022Quote: ... Growth studies were conducted with the BioTek Synergy™2 system (BioTek Instruments) at 37°C with slow shaking ...
-
bioRxiv - Biochemistry 2022Quote: ... Fluorescence intensities were monitored continuously during substrate hydrolysis on Synergy 2 (BioTek®) plate reader for 120 minutes.
-
bioRxiv - Microbiology 2021Quote: Optical density (OD) measurements were performed with an Epoch 2 plate reader (BioTek) at 37 °C with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Images were acquired 2 days after transfection with Cytation 5 imaging reader (Biotek) GFP and mCherry channels ...
-
bioRxiv - Genetics 2020Quote: ... Infected cell frequencies were quantified by mNeonGreen at 2 dpi (Cytation 5, BioTek). In parallel ...
-
bioRxiv - Microbiology 2022Quote: ... Incubation and OD measurements were performed with an Epoch 2 plate reader (BioTek) at appropriate temperatures with continuous shaking and OD600 measured at 7.5-min intervals ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For ATP-independent viability assays ...
-
bioRxiv - Cancer Biology 2022Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cancer Biology 2024Quote: ... Plates were read at 450 nm in a Syngery 2 Plate reader (BioTek).
-
bioRxiv - Microbiology 2023Quote: ... which was recorded over time with an Epoch 2 Microplate Spectrophotometer (BioTek Instruments). All reactions were performed in triplicates of 60 µl each at 25°C in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... The luminescence signal was then measured using a Synergy 2 plate reader (Biotek) according to the manufacturer’s guidelines.e
-
bioRxiv - Cell Biology 2022Quote: ... Absorbance at 600 nm was determined using a Synergy 2 plate reader (BioTek).
-
bioRxiv - Biochemistry 2023Quote: ... the fluorescence intensity was measured using a Synergy 2 multimode microplate reader (BioTek) at excitation and emission wavelengths of 360 and 460 nm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and grown at 28°C in an Epoch 2 Microplate Spectrophotometer (Agilent BioTek). Absorbance at 600nm (OD600 ...
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). Data were normalized to vehicle-only wells.
-
bioRxiv - Cancer Biology 2023Quote: ... before data acquisition using a Synergy 2 or Cytation 5 plate reader (BioTek). For all dose-response curves ...
-
bioRxiv - Cancer Biology 2024Quote: ... and luminescence detected with SynergyTM 2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Microbiology 2024Quote: ... Growth was monitored by measuring A600 every 15min (Epoch 2 or SynergyMx, (Biotek) plate readers) ...
-
bioRxiv - Biochemistry 2024Quote: Peroxidase activity assays were carried out using a Synergy 2 microplate reader (BioTek) at room temperature by following the rate of oxidation of 2,2′-azino bis (3-ethylbenzthiazoline-6-sulfonic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... data acquisition was obtained using a microplate spectrophotometer (Epoch 2; BioTek, Winooski, USA) at wavelengths of 450Lnm ...
-
bioRxiv - Cell Biology 2020Quote: ... The absorbance was measured using Epoch 2 Microplate Spectrophotometer (BioTek Instruments, Inc., Winooski, VT). The average of specific absorbance from at least 3 biological replicates was normalized to 1mM Pi treated group ...
-
bioRxiv - Cancer Biology 2020Quote: ... Absorbance was then measured at 570 nm using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2020Quote: ... Luminescence was detected with Synergy™2 multi-mode microplate reader (BioTek® Instruments). Each experiment was performed in at least triplicate wells in triplicate experiments.
-
bioRxiv - Cancer Biology 2021Quote: ... A Synergy™2 microplate reader with Gen5™ software (BioTek Instruments, Winooski, VT) was used to measure luminescence ...