Labshake search
Citations for Biotek :
101 - 150 of 564 citations for 4 2 Trimethylsilyl Ethyl Aniline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and were incubated in a Synergy™ 2 (Biotek, United States) plate reader at 30°C or 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Luminescent signal was quantified using a Synergy 2 Microplate Reader (Biotek, Winooski ...
-
bioRxiv - Immunology 2020Quote: ... Chemiluminescence was measured using a microplate luminescence reader (BioTek, Synergy 2).
-
bioRxiv - Biophysics 2020Quote: ... and growth was monitored using Epoch 2 Microplate Spectrophotometer reader (BioTek) with the following settings ...
-
bioRxiv - Microbiology 2020Quote: Growth curves were performed with a Synergy 2 plate reader (BioTek) to measure OD600 and GFP fluorescence (Ex485/Em528) ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluorescence intensity was recorded on a Synergy 2 plate reader (BioTek) at ex/em wavelengths of 360 nm/440 nm.
-
bioRxiv - Microbiology 2022Quote: ... was analyzed using a Synergy 2 Multi Mode microplate reader (BioTek).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... SEAP levels were subsequently measured using Synergy 2 microplate reader (Biotek) at 620 nm in absorbance mode ...
-
bioRxiv - Plant Biology 2024Quote: Absorption spectra were recorded in a Synergy 2 microplate reader (BioTek) using UV-Star flat bottom 96 well microplates (Grenier Bio-One ...
-
bioRxiv - Zoology 2024Quote: ... A Synergy 2 Multi-Mode Microplate Reader (BioTek, Winooski, VT, USA) was used to measure the absorbance of each well at 450 nm.
-
bioRxiv - Microbiology 2024Quote: ... Growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2023Quote: ... The stacker was coupled to a Synergy 2 plate reader (BioTek), which read OD and shook the plates for 5 min as often as allowed by the plate reader (~1 h).
-
bioRxiv - Plant Biology 2023Quote: ... ROS production was measured using a Synergy 2 microplate reader (BioTek).
-
bioRxiv - Bioengineering 2023Quote: ... on a fluorescence microplate reader (Biotek Synergy 2 plate reader, USA). dsDNA content was calculated using the standard calibration curve ...
-
bioRxiv - Molecular Biology 2023Quote: ... Growth was measured using the Epoch 2 Microplate Spectrophotometer (BioTek Instruments) set to 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The measurements were performed using a Synergy 2 plate reader (BioTek) with excitation and emission wavelengths of 440nm and 680nm respectively.
-
bioRxiv - Microbiology 2023Quote: ... Growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37 °C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Cancer Biology 2023Quote: ... OD450 was read on a standard plate reader (BioTek Synergy 2) and sample 5-mC content was calculated from a standard curve.
-
bioRxiv - Microbiology 2024Quote: ... and OD600 was monitored by a Synergy 2 microplate reader (BioTek). Data was analyzed using Python and plotted with Matplotlib55.
-
bioRxiv - Bioengineering 2020Quote: ... Samples were read at 500 nm using a Synergy 4 Multi-mode Microplate Reader (BioTek) within 2-5 minutes of NaOH addition ...
-
bioRxiv - Cell Biology 2022Quote: ... Relative luciferase activity was measured using a BioTek SynergyTM 4 multimode microplate reader (BioTek Instruments). The activity of the Gaussia luciferase was normalized with that of Firefly luciferase ...
-
bioRxiv - Biophysics 2020Quote: ... The assay has been adapted to a 96-well format utilizing Synergy 4 (BioTek Instruments) or SpectraMax M3 (Molecular Devices ...
-
bioRxiv - Immunology 2022Quote: ... plates were washed 4 × in Tris Buffered Saline Tween (TBST) using a plate washer (BioTek) and blocked with Casein for 1 h at 37°C ...
-
bioRxiv - Microbiology 2021Quote: OD at 500 nm of subcultures were determined in a Synergy 4 plate reader (BioTek) and subcultures were mixed together in a 1:1 ratio of fluorescent ...
-
bioRxiv - Microbiology 2020Quote: ... Fluorescence (ex: 360nm, em: 530nm) was measured using a Synergy 4 Microplate Reader (BioTek Instruments).
-
bioRxiv - Microbiology 2021Quote: ... the wells were assessed for growth (turbidity) using a BioTek Synergy 4 plate reader (BioTek) or a Spark 10M plate reader (Tecan) ...
-
Dual targeting factors are required for LXG toxin export by the bacterial type VIIb secretion systembioRxiv - Microbiology 2022Quote: ... The OD of the cultures was measured with a Synergy 4 Microplate Reader (Biotek Instruments).
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.