Labshake search
Citations for Biotek :
551 - 600 of 1433 citations for 3 4 Hydroxy 5 isopropyl 6 oxo 1 6 dihydro pyrimidin 2 ylsulfanyl propionic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Immunology 2022Quote: ... was added for 5 min and plates were analyzed using a plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... according to the manufacturer’s instructions and collecting on a Cytation 5 plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... the absorbance was measured at 490 nm using a plate reader (BioTek Cytation 5).
-
bioRxiv - Biochemistry 2021Quote: ... The resulting signals were ratioed using a Cytation 5 Imaging Reader (BioTek, Winooski, VT). Empty luc2P/Hygro vector served as a negative control.
-
bioRxiv - Cell Biology 2021Quote: ... the fluorescence intensity of AmplexUltraRed was measured with a microplate reader (Cytation 5, BioTek).
-
bioRxiv - Neuroscience 2021Quote: ... Bright field images were acquired using a Cytation 5 imager (BioTek Instruments, Winooski, VT).
-
bioRxiv - Microbiology 2020Quote: ... Luminescence was measured on a Cytation™ 5 multimode reader (BioTek, Inc. Winooski, VT). Relative luciferase activity was expressed as fold activation relative to that of the reporter construct alone ...
-
bioRxiv - Microbiology 2021Quote: ... The fluorescence was measured using a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek) at 37°C for 10 min using 30 sec intervals and a 365 nm excitation wavelength and a 450 nm emission wavelength ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fluorescence (Ex/Em 560/590 nm) was then read using a Cytation 5 (BioTek). Fluorescence readings were blank corrected to wells containing only culture medium and results are expressed as a percentage of uninfected cells viability.
-
bioRxiv - Cell Biology 2022Quote: ... Automated bright field imaging using a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek) (4X Plan Fluorite 0.13 NA objective (Olympus) ...
-
bioRxiv - Immunology 2022Quote: ... Luminescence was then read using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Bioengineering 2020Quote: ... OD492 reading was obtained on a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek).
-
bioRxiv - Cancer Biology 2021Quote: ... stained plates were scanned with the Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) and the number and size of colonies were quantified with the compatible Gen5™ Multi-Mode Reader and Imager Software.
-
bioRxiv - Microbiology 2022Quote: ... Representative images were acquired using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) at 20× magnification.
-
bioRxiv - Cancer Biology 2022Quote: ... Images of interphase cells for quantifying nuclear phenotypes were acquired using Cytation 5 (Biotek) using 20x 0.45 NA objective (Olympus ...
-
bioRxiv - Immunology 2022Quote: ... Luminescence was then read using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Microbiology 2022Quote: ... 50) using a microtiter plate reader (Cytation 5 Cell Imaging Multi-Mode Reader, BioTek). Values are expressed as relative fluorescence units (RFU ...
-
bioRxiv - Plant Biology 2022Quote: ... CLX or indole (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
bioRxiv - Immunology 2024Quote: ... and the fluorescence values of the wells were also recorded by Cytation 5 (BioTek).
-
bioRxiv - Bioengineering 2024Quote: ... and recording luminescence intensity with a microtiter well plate reader (BioTek® Cytation 5).
-
bioRxiv - Neuroscience 2023Quote: ... The cells were finally placed in PBS and imaged utilizing a Cytation 5 (Biotek). The antibodies used were mouse anti-DARPP-32 antibody (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2023Quote: ... The quantity and quality of the samples were determined using the Cytation 5 (BioTek) plate reader and Agilent 4150 Tape Station System ...
-
bioRxiv - Cell Biology 2023Quote: ... The absorbance at 595 nm was measured using a Cytation 5 plate reader (BioTek) and Gen5 data analysis software (Windows version 3.05).
-
bioRxiv - Genomics 2023Quote: ... cell counts were measured using a Cytation 5 Cell Imaging Multimode Reader (Agilent BioTek).