Labshake search
Citations for Biotek :
551 - 600 of 1314 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Absorbance (OD, 560 nm) was measured in a microplate reader (Cytation 5, BioTek). Sensitivity to single drug treatments was evaluated by IC50 (4-parameters calculation upon log-scaled doses) ...
-
bioRxiv - Microbiology 2022Quote: ... Plates were imaged using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) at 20× magnification using the automated imaging function to capture 50 non-overlapping images per well ...
-
bioRxiv - Immunology 2022Quote: ... Plates were read at 490 nm on a Cytation 5 microplate reader (BioTek). Analysis was performed using GraphPad Prism 9.3.1 software ...
-
bioRxiv - Immunology 2023Quote: ... Live cell imaging was performed using Citation 5 paired with BioSpa (Biotek/Agilent). Data analysis was achieved with Gen5 software by calculating mCherry MFI ...
-
bioRxiv - Bioengineering 2023Quote: ... Luciferase activity was detected by using a luminescence microplate reader (Cytation 5, BioTek). Neutralizing antibody of selected NHPs was detected as 1:10 dilution at which 50% or less inhibition of the luciferase signal was measured.
-
bioRxiv - Bioengineering 2023Quote: ... and analyzed on the Cytation 5 Gen5 software Image Prime v3.10 (Biotek,USA) using manual mode for phase contrast with LED intensity 8 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and fluorescence values were read at an excitation wavelength of 490 nm and emission wavelength of 525 nm for 6-FAM (fluorescein)-activated fluorescence (Synergy H1, BioTek Gen5 v.2.04). Fluorescence values for a fluorescein concentration in which a single replicate saturated the plate reader were excluded from the analysis ...
-
bioRxiv - Biochemistry 2024Quote: ... The cells with Alamar Blue were further incubated at 37°C for 6 hours, and the fluorescence intensity (excitation 560 nm, emission 590 nm) was measured using Synergy H1 microplate reader (BioTek Instruments, Inc., VA). The fluorescence readings were analysed to determine cell viability ...
-
bioRxiv - Neuroscience 2021Quote: ... Imaging and analysis were performed on a Cytation 3 Cell Imaging Multi-Mode Reader (Biotek, Winooski, VT, U.S.A). Data acquisition and processing was accomplished with Gen 5 software package (Biotek).
-
bioRxiv - Immunology 2021Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Bioengineering 2022Quote: ... The absorbance was measured using a plate reader (Cytation 3 microplate reader, BioTek Instruments Inc, Winooski, VT, USA). The corrected absorbance at 490 nm was plotted versus the concentrations of the drugs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Fluorescence was read at 485/530 nm and at 530/590 nm in a Cytation™ 3 (BioTek) multifunctional microplate reader ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Microscopic images were acquired at 4x magnification using a Cytation 3 Image reader (BioTek Instruments Inc, Winooski, VT) in TIFF format ...
-
bioRxiv - Microbiology 2024Quote: ... GFP-positive cells were automatically counted 22 h post-infection by using Cytation 3 microplate reader (BioTek Instruments).
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were washed (80 μl) 3 times with PBS by using the Washer Dispenser EL 406 from Biotek. Cells were permeabilized with Blocking Buffer (PBS pH 7.5 ...
-
bioRxiv - Microbiology 2024Quote: ... Images of TC-tr minigenome rescue events were then immediately captured on a Cytation 3 plate reader (BioTek) using the blue and red channels ...
-
bioRxiv - Cell Biology 2024Quote: ... Light production was measured using filter cubes #114 and #3 on the Synergy Neo2 Multi-Mode Reader (Biotek), readings for each well were integrated over 200 ms with 4 replicate measurements per well (Gain 135 and read height 6 mm) ...
-
bioRxiv - Microbiology 2024Quote: ... with images captured from a fixed location using the Cytation 3 Cell Imaging Multi-Mode Reader (BioTek, USA).
-
bioRxiv - Bioengineering 2021Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing complex II activity over the pH range 6.6–7.8 ...
-
bioRxiv - Biochemistry 2020Quote: A Synergy 2 Multi-Detection 96-well Microplate Reader (BioTek, Winooski, VT) was used at 37 °C for experiments assessing ROS generation as result of RET over a pH range ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). Genomic DNA from the striatum ...
-
bioRxiv - Microbiology 2021Quote: ... Luminescence of samples was detected by a BioTek reader (Synergy 2, BioTek). For each experiment ...
-
bioRxiv - Cell Biology 2022Quote: ... The luminescence signal was quantified using a plate reader (Synergy 2, BioTek).
-
bioRxiv - Cancer Biology 2022Quote: ... The absorbance was measured by using a spectrophotometer (Epoch 2, Biotek Instruments).
-
bioRxiv - Microbiology 2022Quote: ... Cell growth was measured in an Epoch 2 microplate spectrophotometer (BioTek Instruments) at 37°C with 237 cpm continuous shaking until the median optical density (OD ...
-
bioRxiv - Genomics 2022Quote: Yeast growth rates were analyzed using the Epoch 2 Microplate Spectrophotometer (BioTek) and the doubling time interval was calculated using the yeast outgrowth data analyzer (YODA ...
-
bioRxiv - Neuroscience 2020Quote: ... luminescence was recorded using a Synergy 2 Multi-Detection Microplate Reader (BioTek) with a read height of 1mm ...
-
bioRxiv - Microbiology 2020Quote: ... The growth was tracked in an Epoch 2 Microplate Spectrophotometer (BioTek Instruments) at 37°C with linear shaking at 237 cpm (4 mm ...
-
bioRxiv - Microbiology 2021Quote: ... OD600 was measured in a Synergy 2 microplate reader (Biotek, Winooski, VT) set at 30 °C for 24 h aerated every hour by shaking for 10 sec before each read ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Luminescence was measured on a Synergy 2 microplate reader (BioTek, Winooski, VT). At least six wells per drug dose for both assays were performed ...
-
bioRxiv - Genetics 2021Quote: ... we read the luminescence output using a Synergy 2 plate reader (BioTek). Luciferase values were normalized by Renilla luciferase to control for transfection efficiency and cell death ...
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Immunology 2022Quote: ... was added for 5 min and plates were analyzed using a plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... according to the manufacturer’s instructions and collecting on a Cytation 5 plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... the absorbance was measured at 490 nm using a plate reader (BioTek Cytation 5).
-
bioRxiv - Biochemistry 2021Quote: ... The resulting signals were ratioed using a Cytation 5 Imaging Reader (BioTek, Winooski, VT). Empty luc2P/Hygro vector served as a negative control.
-
bioRxiv - Cell Biology 2021Quote: ... the fluorescence intensity of AmplexUltraRed was measured with a microplate reader (Cytation 5, BioTek).
-
bioRxiv - Neuroscience 2021Quote: ... Bright field images were acquired using a Cytation 5 imager (BioTek Instruments, Winooski, VT).