Labshake search
Citations for Biotek :
501 - 550 of 1335 citations for 5 1 3 benzothiazol 2 ylamino pentanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... The concentration of RNA was determined using Epoch 2 microplate spectrophotometer (BioTek).
-
bioRxiv - Cell Biology 2021Quote: ... OD600 values were measured on an Epoch 2 Microplate Spectrophotometer (BioTek #EPOCH2NS) every 5 minutes for at least 19 hours at 30°C with orbital shaking ...
-
bioRxiv - Microbiology 2022Quote: ... These bacteria were incubated anaerobically in an Epoch 2 Microplate Spectrophotometer (BioTek) at a 1:10 ratio in a final culture volume of 200 µl per well in 12 wells of a 96-well plate for 1 hour in 1:1 rBHI:fecal slurry ...
-
bioRxiv - Plant Biology 2022Quote: ... Lycopene absorbance was then measured by a spectrophotometer (Biotek Epoch 2, www.biotek.com) at 503 nm and converted into lycopene concentration in the fruits (mg/kgfw ...
-
bioRxiv - Microbiology 2023Quote: ... Luminescence was measured using a luminometer (BioTek Synergy™ 2 microplate reader).
-
bioRxiv - Cancer Biology 2023Quote: ... measuring luminescence with a BioTek Synergy 2 (BioTek/Agilent, Winooski, VT, USA). Cells were treated with NCA following its synthesis detailed in supplementary methods ...
-
bioRxiv - Microbiology 2024Quote: ... were measured using the Synergy™ 2 Multi-Detection Microplate Reader (BioTek).
-
bioRxiv - Neuroscience 2024Quote: ... Genomic DNA concentrations were determined using the Synergy 2 Plate Reader (BioTek). CAG repeat-spanning HTT PCR products from both the HttQ111/+ and HttLacO-Q140 cohorts were amplified from genomic DNA using 6-FAM-labeled CAG1 forward primer (5’ ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 3’ ...
-
bioRxiv - Microbiology 2024Quote: ... and A600 value were measured using a plate reader (Epoch 2; Biotek). Data were collected at 10 min intervals for 60 h.
-
bioRxiv - Physiology 2024Quote: ... and 450 nm wavelength was read by Synergy 2 microplate reader (Biotek).
-
bioRxiv - Cancer Biology 2024Quote: ... The plates were read with a microplate-reader (Biotek synergy 2, Tecan) at 510 nm.
-
bioRxiv - Bioengineering 2024Quote: ... Absorbance was measured at 340 mM using Epoch 2 Microplate Spectrophotometer (BioTek). One unit of xylose reductase activity was defined as μmol of NAD(P)H oxidized per minute ...
-
bioRxiv - Immunology 2022Quote: ... was added for 5 min and plates were analyzed using a plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... according to the manufacturer’s instructions and collecting on a Cytation 5 plate reader (BioTek).
-
bioRxiv - Bioengineering 2021Quote: ... the absorbance was measured at 490 nm using a plate reader (BioTek Cytation 5).
-
bioRxiv - Biochemistry 2021Quote: ... The resulting signals were ratioed using a Cytation 5 Imaging Reader (BioTek, Winooski, VT). Empty luc2P/Hygro vector served as a negative control.
-
bioRxiv - Cell Biology 2021Quote: ... the fluorescence intensity of AmplexUltraRed was measured with a microplate reader (Cytation 5, BioTek).
-
bioRxiv - Neuroscience 2021Quote: ... Bright field images were acquired using a Cytation 5 imager (BioTek Instruments, Winooski, VT).
-
bioRxiv - Microbiology 2020Quote: ... Luminescence was measured on a Cytation™ 5 multimode reader (BioTek, Inc. Winooski, VT). Relative luciferase activity was expressed as fold activation relative to that of the reporter construct alone ...
-
bioRxiv - Microbiology 2021Quote: ... The fluorescence was measured using a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek) at 37°C for 10 min using 30 sec intervals and a 365 nm excitation wavelength and a 450 nm emission wavelength ...
-
bioRxiv - Molecular Biology 2021Quote: ... Fluorescence (Ex/Em 560/590 nm) was then read using a Cytation 5 (BioTek). Fluorescence readings were blank corrected to wells containing only culture medium and results are expressed as a percentage of uninfected cells viability.
-
bioRxiv - Cell Biology 2022Quote: ... Automated bright field imaging using a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek) (4X Plan Fluorite 0.13 NA objective (Olympus) ...
-
bioRxiv - Immunology 2022Quote: ... Luminescence was then read using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Bioengineering 2020Quote: ... OD492 reading was obtained on a Cytation 5 Cell Imaging Multi-Mode Reader (Biotek).
-
bioRxiv - Cancer Biology 2021Quote: ... stained plates were scanned with the Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) and the number and size of colonies were quantified with the compatible Gen5™ Multi-Mode Reader and Imager Software.
-
bioRxiv - Microbiology 2022Quote: ... Representative images were acquired using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek) at 20× magnification.
-
bioRxiv - Cancer Biology 2022Quote: ... Images of interphase cells for quantifying nuclear phenotypes were acquired using Cytation 5 (Biotek) using 20x 0.45 NA objective (Olympus ...
-
bioRxiv - Immunology 2022Quote: ... Luminescence was then read using a Cytation 5 Cell Imaging Multi-Mode Reader (BioTek).
-
bioRxiv - Microbiology 2022Quote: ... 50) using a microtiter plate reader (Cytation 5 Cell Imaging Multi-Mode Reader, BioTek). Values are expressed as relative fluorescence units (RFU ...
-
bioRxiv - Plant Biology 2022Quote: ... CLX or indole (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
bioRxiv - Immunology 2024Quote: ... and the fluorescence values of the wells were also recorded by Cytation 5 (BioTek).
-
bioRxiv - Bioengineering 2024Quote: ... and recording luminescence intensity with a microtiter well plate reader (BioTek® Cytation 5).
-
bioRxiv - Neuroscience 2023Quote: ... The cells were finally placed in PBS and imaged utilizing a Cytation 5 (Biotek). The antibodies used were mouse anti-DARPP-32 antibody (Santa Cruz Biotechnologies ...
-
bioRxiv - Physiology 2023Quote: ... The quantity and quality of the samples were determined using the Cytation 5 (BioTek) plate reader and Agilent 4150 Tape Station System ...
-
bioRxiv - Cell Biology 2023Quote: ... The absorbance at 595 nm was measured using a Cytation 5 plate reader (BioTek) and Gen5 data analysis software (Windows version 3.05).
-
bioRxiv - Genomics 2023Quote: ... cell counts were measured using a Cytation 5 Cell Imaging Multimode Reader (Agilent BioTek).
-
bioRxiv - Molecular Biology 2023Quote: ... Imaging of fixed cells was performed using the Cytation 5 Multi-Mode Reader (BioTek). Total G4 staining was quantified by applying a digital threshold of intensity for each image using ImageJ software ...
-
bioRxiv - Molecular Biology 2023Quote: ... The absorbance was measured at 450 nm with a microplate reader (Biotek Cytation 5).
-
bioRxiv - Cancer Biology 2023Quote: ... plates were transferred to the Cytation 5 Cell Imaging Multi-Mode Reader (Biotek/Agilent) driven by Gen5 software (Biotek/Agilent) ...
-
bioRxiv - Cell Biology 2023Quote: ... The fluorescence of pyrene was monitored using a fluorescence spectrophotometer (Cytation 5, BioTek, USA). The obtained data were analyzed and plotted using Origin software (Originlab Corporation ...
-
bioRxiv - Bioengineering 2024Quote: ... Sample fluorescence was measured by a Cytation 5 fluorospectrophotometer (BioTek Instruments, Inc., Winooski, VT) at ex ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were then washed three times with PBS before imaging using Cytation 5 (Biotek). Image analysis was performed using GIMP 2.10.30.
-
bioRxiv - Microbiology 2024Quote: ... Infectivity was quantified by luminescence signal using Cytation 5 cell imaging multimode reader (Biotek) with the following run parameters ...
-
bioRxiv - Biochemistry 2024Quote: ... or ortho-vanadate (50 μM) was quantified using a Cytation 5 reader (BioTek Instruments).
-
bioRxiv - Physiology 2024Quote: ... The quantity and quality of the samples were determined using the Cytation 5 (BioTek) plate reader and Agilent 4150 Tape Station System ...
-
bioRxiv - Immunology 2022Quote: ... Reactions were stopped by adding 50 μL 3M hydrochloric acid and absorbance at 492 nm was determined on a Synergy 4 plate reader (BioTek, Agilent Technologies inc., CA, USA) or similar ...
-
bioRxiv - Microbiology 2021Quote: ... the plate was washed 3 times with 300 uL of supplied wash buffer using a microplate washer (Biotek 405TS). 100 µL of enzyme conjugate was added to the wells and incubated at 37°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cellular abundance was read out 72 hours later using the Presto Blue assay (Thermo) on a Cytation 3 (BioTek) plate reader ...
-
bioRxiv - Cell Biology 2021Quote: ... and the emitted light was detected at 510 nm using a Cytation 3 Cell Imaging Multi-Mode Reader (BioTek) at sequential 30-second intervals ...
-
bioRxiv - Microbiology 2021Quote: ... Viability was quantified by fluorescent measurement (Ex. 560 nm, Em. 590 nm) in a Cytation 3 microplate reader (Biotek). Fluorescence values were normalized to DMSO (100% viability ...