Labshake search
Citations for R&D Systems :
251 - 300 of 884 citations for Vertical Electrophoresis Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Cell lines were tested for mycoplasma using the MycoProbe Mycoplasma Detection kit (R&D Systems).
-
bioRxiv - Immunology 2022Quote: ... TSLP and pCol1 in cell culture supernatants were determined using ELISA kits (R&D System for Areg ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were screened for mycoplasma contamination using the MycoProbe Mycoplasma Detection Kit (R&D Systems), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Primary B cell complete media also contains 5 ng/ml of BAFF (R&D Systems).
-
bioRxiv - Microbiology 2020Quote: ... CD4+ TN or TCM cells were treated with either 100nM CCL-19 (R&D Systems) or 10U/ml IL-2 and 2 μg/ml PHA as described ...
-
bioRxiv - Molecular Biology 2020Quote: Mice fibroblast cells (FLS) treated with 5 ng/mL recombinant human TNF (R&D Systems) for 16 hours were harvested at 95% confluence ...
-
bioRxiv - Immunology 2020Quote: ... isolated NK cells were cultured in 1000 IU/mL human IL-2 (R&D Systems) for 24 hours ...
-
bioRxiv - Microbiology 2021Quote: ... cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then incubated in primary antibodies (SOX17-R&D Systems, AF1924, SOX2-Millipore, ab5603) diluted at 1:500 in 2% horse serum ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated in SFD medium supplemented with 100ng/ml human Noggin (R&D Systems) and 10μM SB431542 for 24 hours followed by switching to SFD media supplemented with 10 μM SB431542 and 1 μM IWP2 (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated with goat pAB anti-hACE2-647 (1:100, FAB933R R&D Systems) and/or with antibodies recognizing the spike protein of SARS-CoV (anti-S ...
-
bioRxiv - Genetics 2019Quote: ... Cells were washed and re-suspended in Flow Cytometry Staining Buffer (FC001, R&D Systems) before loading into an Attune Nxt Flow Cytometer (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were then treated with 125 ng/ml recombinant EGF (R&D Systems: 236-EG) for 1 hour and collected for western blot analysis ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then cultured with bone morphogenic protein-4 (BMP-4; R&D Systems) and CHIR-99021 in RPMI-B27 medium to specify for cardiac mesoderm lineages ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were treated with 5 ng/mL recombinant human TGFβ1 (R&D Systems, 240-B) prepared according to the manufacture’s specifications ...
-
bioRxiv - Bioengineering 2023Quote: ... as well as the Human Mesenchymal Stem Cells Multi-Color Flow Kit (R&D Systems) including antibodies for positive markers CD44 ...
-
bioRxiv - Developmental Biology 2023Quote: ... the cells were cultured in BE3 supplemented with 50 ng/mL FGF10 (R&D systems), 330 nM Indolactam V (Cayman) ...
-
bioRxiv - Immunology 2023Quote: ... cells were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated with anti-MHC antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were stained for 15 min at room temperature with ITGA7-Alexa647 (R&D systems) for positive selection ...
-
bioRxiv - Immunology 2023Quote: ... T cell were pre-incubated with 1 mg/ml pertussis toxin (3097; R&D Systems) in RPMI-10 medium for 3 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... cells were treated with 25 ng/ml human IL-17 recombinant protein (R&D Systems). Vehicle control or 25 ng/ml human TNF-α recombinant protein were used as controls ...
-
bioRxiv - Neuroscience 2023Quote: ... the cells were stimulated with 100 nM CCL2 (R&D Systems # 3144-JE-025/CF) or 10 mM pepducin ...
-
bioRxiv - Immunology 2024Quote: ... TET2 knock-in T-cells were incubated with a Cetuximab biosimilar (R&D Systems, #MAB9577) at a concentration of 2000 ng/mL for 20 minutes ...
-
bioRxiv - Cell Biology 2024Quote: PAECs (3.000 cells/chamber) were seeded onto fibronectin-coated (10 μg.mL-1; R&D Systems) 4-chamber slides (Nunc) ...
-
bioRxiv - Cancer Biology 2023Quote: ... HN30 and UMSCC47 cells were cultured in DMEM supplemented with 10% FBS (R&D Systems). UMSCC104 were cultured in EMEM (Quality Biological Inc ...
-
bioRxiv - Molecular Biology 2023Quote: MEG-01 cells were incubated with pan-Caspase inhibitor Z-VAD-FMK (R&D Systems) up to a concentration of 10 μM ...
-
bioRxiv - Cell Biology 2023Quote: Apoptosis of tumor cells was determined with an Annexin-FITC staining kit (R&D Systems) as per the manufacturer’s instructions and analyzed by flow cytometry ...
-
bioRxiv - Immunology 2024Quote: ... Cells were counted and plated in 20ng/mL GM-CSF (Peprotech or R&D Systems) and 2ng/mL TGF-β (R&D Systems) ...
-
bioRxiv - Immunology 2024Quote: ... the cells were incubated with IFNγ (100 ng/ml, R&D Systems 485-MI-100) and LPS (100 ng/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... mOSE cells were plated 24hrs prior to the addition of TGFB1 (10ng/mL, R&D Systems) and cells were collected after 4 days of treatment ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were incubated over night at 4 °C with the anti-CD140a (R&D Systems AF1062) diluted 1:80 in blocking solution ...
-
bioRxiv - Immunology 2021Quote: ... Levels of IL-1β or TNF in cell supernatants were quantified by ELISA (R&D Systems).
-
bioRxiv - Immunology 2021Quote: ... TF-I cells medium contained 2 ng/ml of recombinant human GM-CSF (R&D Systems). Cells have been cultured for no longer than 4 weeks after thawing and were regularly tested for Mycoplasma contamination using PCR technique and were confirmed to be negative.
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were preincubated for 10min with 30µg rat anti-human neuropilin1 Fc chimera (R&D System) or 20µg goat anti-human neuropilin2 Fc chimera (R&D System ...
-
bioRxiv - Neuroscience 2020Quote: ... cell media included RPMI-1640 Glutamax (Life-Technologies) supplemented with 10% FBS (R&D Systems/biotechne), 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... The level of IL-1β in cell culture supernatants was measured using ELISA (R&D systems) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Genomics 2022Quote: ... cells were incubated with indicated concentrations (Figure 1B) of human TGF-β1 protein (R&D systems) in the complete culture medium ...
-
bioRxiv - Immunology 2022Quote: ... cells were cultured with Areg (R&D Systems, #989-AR-100, 10 or 100 ng/ml) or heptelidic acid (Adipogen ...
-
bioRxiv - Immunology 2022Quote: ... Non-pathogenic Th17 cell differentiation was performed with IL-6 (25 ng/mL, R&D Systems) and TGF-β1 (2 ng/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were exposed for 2 days to human Activin A (8 ng/ml, R&D Systems) and human bone morphogenetic protein 4 (hBMP4 ...
-
bioRxiv - Cancer Biology 2022Quote: Medium from cells was harvested and used in the Human Cytokine Array Kit (R&D Systems), as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK 293T cells were seeded on plates coated with Cultrex Poly-L-Lysine (R&D Systems) prior to transfection with the pCCl-c-MNDU3 STEAP1-BBζ CAR lentiviral plasmid and the packaging plasmids pMDL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were changed into fresh media supplemented with DMSO or 600ng/mL IFNγ (R&D Systems) and incubated for 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... the INS-1 cells were treated with recombinant mouse IFNγ (1000 units/mL; R&D Systems) and recombinant human IL-1β (50 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: Mouse myelogenous leukemia (M-NFS-60) cells were M-CSF (R&D systems, 216-MC/CF) starved for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Sox2 was used as a neuronal stem cell marker (mouse, MAB2018, R&D Systems, 1:100), Tuj1 (mouse ...