Labshake search
Citations for R&D Systems :
401 - 450 of 589 citations for GABA Rabbit Polyclonal Conjugated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... mouse anti-human Pref-1/DLK1/FA1 APC-conjugated antibody (R&D Systems, FAB1144A; RRID:AB_2890004), and mouse anti-human CD10 (Biocare Medical ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-m/rCD31/PECAM-1 Alexa Fluor 488 Conjugated (1:50, FAB3628G; R&D Systems); Claudin-5 (1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... and then anti-goat horseradish peroxidase-conjugated antibody (Catalog #HAF017, R&D Systems, Minneapolis, MN) was added at 1:1000 dilution at room temperature for 1 hour ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... or CD31/PECAM-1 Alexa Fluor 488-conjugated Antibody (1:200; R&D system #FAB3628G). After primary antibody incubation ...
-
bioRxiv - Microbiology 2023Quote: ... and LYVE-1 conjugated to A647 (clone 223322 R&D systems, used at 20 μg). A temporary glass window (Merk rectangular coverglass ...
-
bioRxiv - Microbiology 2023Quote: ... or with isotype controls (Alexa Fluor® 488-conjugated mouse IgG1 (R&D systems, USA) and Alexa Fluor® 700-conjugated rat IgG2 (Novus Biologicals ...
-
bioRxiv - Genomics 2024Quote: ... at a 1:20 dilution and Alexa Fluor 647-conjugated O1 (R&D Systems FAB1327R) at a 1:20 dilution.
-
bioRxiv - Neuroscience 2019Quote: ... MSD GOLD 96-Well Streptavidin plates were blocked with 3% BSA and coated with a solution containing 0.25 µg/ml biotinylated polyclonal goat anti-human TREM2 capture antibody (BAF1828, R&D Systems, Minneapolis, MN). CSF and plasma samples diluted 1:4 in 1% BSA were added to the prepared plates and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Detection of bound sIL7R was carried out by one-hour incubation at room temperature with biotinylated goat anti-human IL7R polyclonal antibody (R&D Systems, # BAF306), followed by 30-minute incubation at room temperature with streptavidin-horseradish peroxidase (Millipore Sigma ...
-
bioRxiv - Immunology 2020Quote: ... paraformaldehyde-fixed frozen sections were treated with citrate buffer (pH 7.0, 121°C, 5 min) before immunostaining with sheep anti-mouse Spi-B polyclonal Ab (R&D Systems, Abingdon, UK). CCL20 ...
-
bioRxiv - Biochemistry 2020Quote: ... The membrane was then washed 3x in TBST and incubated for 1 h with anti-CatL polyclonal IgG (R&D Systems, AF952-SP) diluted 1:1,000 in TBST followed by 30 min with rabbit anti-goat HRP IgG (SouthernBiotech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were removed from adherent cultures using AssayComplete cell dissociation reagent (Eurofins #92-0009) and incubated with a polyclonal anti-ALK2 antibody (R&D Systems #AF637) or a polyclonal anti-ALK3 antibody (Sino Biological #50078-RP02) ...
-
bioRxiv - Neuroscience 2023Quote: ... Trem2 measurements were made using the Mesoscale Discovery (MSD) platform as previously described (29, 105) using a biotinylated anti-mTrem2 polyclonal antibody (R&D Systems BAF1729) as capture antibody and a sulfo-tagged detection antibody (sheep anti-mouse Trem2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... POSTN protein expression in the medium was confirmed using an ELISA assay with an anti-POSTN polyclonal antibody (R&D Systems, Cat # AF3548). 3T3-CTL cells were used to generate “control” conditioned medium (CMCTL) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Then sections were incubated overnight at 4 ◦C with goat polyclonal anti-S100a10 antibody (1:200; AF2377, R&D Systems, Minneapolis, MN, USA), rabbit polyclonal anti-5HT1B Receptor antibody (1:100 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sections from formalin-fixed paraffin-wax embedded tumours were stained with primary rat anti-mouse monoclonal anti-CD8 antibody (eBioscience, 4Sm15as) and goat anti-mouse polyclonal anti-PD-L1 antibody (R&D systems, AF1019). Slides were scanned and imaged using Hamamatsu Nanozoomer (Hamamatsu Photonics).
-
bioRxiv - Molecular Biology 2023Quote: ... Incorporation of HNV-RBP and HNV-F were detected with rabbit anti-HA antibody (Novus Cat. No. NB600-363) and rabbit anti-AU1 antibody (R&D systems nnb600-453), respectively ...
-
bioRxiv - Neuroscience 2019Quote: ... anti-α5-GABAA receptor (rabbit, 1:1,000, R&D Systems), anti-NR1 (rabbit monoclonal [1.17.2.6] ...
-
bioRxiv - Cell Biology 2021Quote: ... cleaved Caspase 3 (rabbit, R&D systems MAB835, 1:500), CPE (rabbit ...
-
bioRxiv - Neuroscience 2022Quote: ... donkey anti-rabbit-A557 (1:2000, R&D systems NL004), goat anti-rabbit-A488 (1:2000 ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-phospho-GluA1 (Ser845, 1:1000, R&D Systems), mouse anti-GluA1 (1:2000 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and rabbit IgG control (1:100 dilution; R&D systems, Minneapolis ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit anti-activated CASP3 (1:500; R&D Systems, AF835), and rabbit anti-TAK1 (1:500 ...
-
bioRxiv - Microbiology 2023Quote: ... and goat α-rabbit IgG-HRP (R&D Systems; HAF008). SuperSignal West Femto Maximum Sensitivity Substrate (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... 150 mM NaCl) with 0.1% Tween 20) for 30 minutes and probed with primary antibodies: polyclonal goat anti-C3d (R&D systems, AF2655, 1:1000), polyclonal sheep anti-Sez6L2 (R&D Systems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Cells were aspirated and incubated overnight at 4°C with either: primary goat polyclonal antibody to Human ACE-2 (AF933; R&D Systems; 1:100); primary rabbit monoclonal antibody to TMPRSS2 (ab92323 ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentration was measured with BCA assay and 350 µg of lysates were incubated with 5 μg of anti-Siglec-E antibody (polyclonal goat IgG - R&D Systems – cat. AF5806) or goat IgG for 2h at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then stained with phycoerythrin (PE)-conjugated anti-sheep secondary antibody IgG (F0126, R&D systems). Cell sorting was conducted on a BD FACSAria IIu cell sorter (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse mAb to βIII-tubulin conjugated to Alexa488 (Clone Tuj-1, R&D Systems, 1/500), mouse mAb to HNK-1 described previously ((Tucker et al. ...
-
bioRxiv - Immunology 2022Quote: ... The appropriate HRP-conjugated secondary antibodies were used at 1:5000 (1:5000; R&D Systems). For a detailed list of reagents ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Immunology 2024Quote: ... Human/Mouse ROR gamma t/RORC2/NR1F3 PE-conjugated Antibody (1:10, IC6006P, R&D Systems), and Human/Mouse/Rat FoxP3 PE-conjugated Antibody (1:10 ...
-
bioRxiv - Neuroscience 2023Quote: The following antibodies were used for in vitro biotinylation (dilutions for each antibody are indicated in parentheses): chicken polyclonal antibody anti-neurofascin (1:1000; R&D Systems Cat# AF3235, RRID:AB_10890736), rabbit polyclonal anti-NrCAM (1:1000 ...
-
bioRxiv - Neuroscience 2023Quote: The following antibodies were used for immunofluorescence studies (dilutions for each antibody are indicated in parentheses): chicken polyclonal anti-neurofascin (1:500; R&D Systems Cat# AF3235, RRID:AB_10890736), chicken polyclonal anti-MAP2 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... Mouse VEGFR3 domains 1-4 and 4-7 were detected by probing with the polyclonal goat anti-mouse VEGFR3 antibody (R&D Systems, AF743, 1:1000) against the extracellular domain of VEGFR3 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then incubated overnight at 4°C with two primary antibodies: mouse monoclonal anti-HMGB1 (1:1000; HMGBiotech) and goat polyclonal anti-CXCL12 (1:50; R&D Systems, #AF-130-NA). Following three washes with 0.2% BSA/PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... or their isotype controls Mouse IgG1 Control Alexa Fluor 488 conjugated (R&D Systems; Cat. No. IC002G) and Mouse IGG1 kappa Isotype (eBioscience ...
-
bioRxiv - Cell Biology 2022Quote: ... stromal cells were incubated with phycoerythrin (PE)-conjugated anti-CD140b antibody (R&D Systems, Minneapolis, MN, USA) for 45 mins at 4°C followed by another 15 mins incubation with anti-mouse IgG1 magnetic microbeads (Miltenyi Biotech) ...
-
bioRxiv - Cancer Biology 2021Quote: ... One tube received the Alexa Fluor-488 conjugated anti-HER3 antibody (FAB3481G; R&D Systems, Minneapolis, MN). Cells were incubated with conjugated antibody at 1:100 for 1 h at RT in the dark ...
-
bioRxiv - Bioengineering 2022Quote: ... Alexa Fluor® 647-conjugated anti-human lymphatic vessel endothelial receptor-1 (LYVE-1 ,R&D Systems) or Alexa Fluor™ 488-conjugated anti-human laminin (R&D Systems ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were incubated with APC-conjugated anti-human Cx43 antibody (R&D Systems, FAB7737A; Supplementary table 1) for 30 min at 4°C in the dark.
-
bioRxiv - Cell Biology 2020Quote: Unconjugated and Alexa 647-conjugated mouse uPAR antibody were from R&D systems (MAB531 and FAB531R, respectively); TLR4 antibody (MAB27591 ...
-
bioRxiv - Microbiology 2022Quote: ... The anti-DC-SIGN phycoerythrin-conjugated fragment antigen binding (Fab) 1621P was purchased from R&D Systems. Soluble C6-GlcCer was purchased from Cayman Chemical and dissolved in methanol ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were labeled with anti-human SSEA-4 APC-conjugated antibody (1:100, R&D Systems) at 37°C for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... The human IL-1β antibody and goat IgG HRP-conjugated antibody were purchased from R&D Systems. Potassium phosphate ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Active Caspase-3 (R&D Systems; AF835; 1:250); mouse anti-Mucin 5AC (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... phosphorylated PGC-1αS570 (rabbit 1:1000; R&D Systems; RRID: AB_10890391) and β-actin (rabbit 1:1000 ...