Labshake search
Citations for R&D Systems :
451 - 500 of 2582 citations for B Cell Activating Factor BAFF TNFSF13B Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 5% CO2 for 8 days with 100 ng/ml macrophage colony-stimulating factor (M-CSF; R&D systems, cat.no 216-MC). Fully differentiated macrophages were harvested and seeded at the required density for the subsequent experiments.
-
bioRxiv - Neuroscience 2023Quote: ... For hCO the neural medium was supplemented with the growth factors EGF (20 ng ml−1, R&D Systems, 236-EG) and FGF2 (20 ng ml−1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated tissue pellet was resuspended in cold Cultrex® Reduced Growth Factor BME type 2 (Cultrex BME) (R&D systems) and 25 mL drops per well were plated on pre-warmed 48-well plates ...
-
bioRxiv - Microbiology 2023Quote: ... 100 µg/ml streptomycin and either 5 ng/ml granulocyte-macrophage colony-stimulating factor (GM-CSF; R&D Systems, Abingdon, UK) to promote M1-differentiation or 20 ng/ml macrophage colony-stimulating factor (M-CSF ...
-
bioRxiv - Microbiology 2024Quote: ... Monocytes were differentiated into hMDMs for at least 7 days in complete medium containing 10 ng.mL-1 of recombinant human macrophage colony-stimulating factor (rhM-CSF; R&D systems).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were incubated with anti-MHC primary antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400 ...
-
bioRxiv - Genomics 2021Quote: ... Cells were then incubated in primary antibodies (SOX17-R&D Systems, AF1924, SOX2-Millipore, ab5603) diluted at 1:500 in 2% horse serum ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated with anti-MHC antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400) ...
-
bioRxiv - Immunology 2023Quote: ... cells were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Developmental Biology 2020Quote: ... or Tgfb1/2/3 ligands (10ng/ml, each) (R&D systems, 240-B/302-B2/243-B3) was placed in the upper and lower chambers ...
-
bioRxiv - Physiology 2019Quote: ... fully differentiated mouse or human brown adipocytes were incubated with 100ng/ml activin B (R&D Systems) in DMEM/F12 supplemented with 10% FBS and 100µg/ml penicillin-streptomycin for 24h before lysis and for RNA extraction of RNA (as indicated below) ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant TGF-β1 (#240-B-002) and human growth hormone Genotropin (Pfizer) procured from R&D Systems.
-
bioRxiv - Molecular Biology 2022Quote: ... Human TGF-β1 (240-B) and IL-1β (201-LB-005) were purchased from R&D systems.
-
bioRxiv - Cancer Biology 2023Quote: ... Inhibitors used in the study are Recombinant Human TGF-β1 protein (R&D Systems, 240-B-002), SAHA (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... TGF-β pathway was stimulated by adding rhTGF-β1 ligand (2ng/mL; R&D Systems; 240-B) for 24 hours ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... The medium was replaced with fresh differentiation medium containing 10 ng/mL VEGF-B (R&D Systems) every two days ...
-
bioRxiv - Neuroscience 2022Quote: ... The cells were cultured for 96 hours with MOG35-55 peptide (50 μg/mL) and Th17-polarizing factors as follows: recombinant murine (rm)IL-23 (8 ng/ml; R&D Systems), rmIL-1α (10 ng/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... and seeded in RPMI 1640 supplemented with 10% serum and 10 ng/ml recombinant macrophage colony-stimulating factor (M-CSF; R&D Systems) for 3 days ...
-
bioRxiv - Immunology 2019Quote: ... from wild type and Irak1−/− mice were prepared by differentiation for 6 days in the same culture medium containing macrophage colony-stimulating factor (M-CSF; 60 ng/mL, R&D Systems). LPS was from Alexis Biochemicals (Salmonella minnesota R595 TLR grade ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were added to the culture plates at the density of 2.0 x 106 cells / dish in a final volume of 10 mL of complete RPMI-1640 supplemented with 20 ng/mL GM-CSF (granulocyte-macrophage colony stimulating factor; R&D Systems). After 3 days ...
-
bioRxiv - Bioengineering 2021Quote: ... dickkopf-related protein-1 (Dkk-1) and transforming growth factor beta 1 (TGF-β1) were obtained from R&D systems (Minneapolis, MN) and performed on conditioned media from hMSCs grown on GelMA and OCM-GelMA microcarriers in RWV bioreactors.
-
bioRxiv - Microbiology 2021Quote: ... gradient and treated with macrophage colony stimulator (M-CSF) or granulocyte-macrophage-stimulating factor (GM-CSF) and IL-4 (R&D system) respectively for 7 days ...
-
bioRxiv - Cell Biology 2020Quote: ... serum starved at 37°C in MV2 medium (containing no growth factors) 3 hrs before stimulation with VEGFA164 (50 ng/ml; R&D Systems), followed by fixation in 3% PFA for 3 min ...
-
bioRxiv - Neuroscience 2019Quote: ... for 24h or with 10 ng/mL tumor necrosis factor alpha and 10ng/ml IL1-ß(R&D Systems; 401-ML-005) for 24h ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Intestinal organoids were grown in base culture media (Advanced DMEM/F12 media, HEPES, GlutaMax, penicillin, and streptomycin) supplemented with growth factors (EGF, Noggin, R-spondin, R&D Systems), B27 (Life Technologies) ...
-
bioRxiv - Genetics 2020Quote: ... femurs and tibias were harvested and bone-marrow cells were obtained by flushing bones and differentiated for 7 days in DMEM media supplemented with 50 mg ml-1 recombinant macrophage-colony stimulating factor (M-CSF, R&D systems), 20% heat-inactivated FBS ...
-
bioRxiv - Biochemistry 2021Quote: ... Intestinal organoids were grown in base culture media (Advanced DMEM/F12 media, HEPES, GlutaMax, penicillin, and streptomycin) supplemented with growth factors (EGF, Noggin, R-spondin, R&D Systems), B27 (Life Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... and then treated with macrophage colony stimulator (M-CSF) or granulocyte-macrophage-stimulating factor (GM-CSF) and IL-4 (R&D system) for 7 days.
-
bioRxiv - Immunology 2021Quote: ... IL-6 and tumour necrosis factor (TNF) in the supernatant were analysed by enzyme-linked immunosorbent assay (ELISA; DuoSet, R&D systems) according to the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: ... either vehicle (PBS) or candidate factors were added at the following concentrations: BDNF (5ng/mL, R&D Systems, Cat# 248-BDB-005), GDNF (5ng/mL ...
-
bioRxiv - Immunology 2022Quote: ... The differentiation to macrophages was initiated at day 0 by the addition of 20 ng/mL macrophage colony-stimulating factor (M-CSF, R&D Systems). Cells were cultured afterwards at 37°C and 5% CO2 for 7 days including the replacement of supplemented DMEM and replenishment of M-CSF at days 1 and 4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryonic NSC media was prepared as above without epidermal growth factor and with the addition of 50 ng/mL mouse bone morphogenetic protein 4 (R&D Systems, 5020-BP-010 ...
-
bioRxiv - Microbiology 2022Quote: ... were obtained from healthy human blood donors after preparing blood monocyte monolayers and culturing for 2 days in medium containing macrophage colony-stimulating factor (R&D Systems) as described previously (56 ...
-
bioRxiv - Cell Biology 2024Quote: ... crypts per isolated from murine intestine and cultured in domes of Cultrex Pathclear Reduced Growth Factor Basement Membrane Extract (3533-005, R&D Systems), covered by ENR media comprised of Advanced DMEM/F12 (12634028 ...
-
bioRxiv - Cell Biology 2024Quote: ... into a 96-well plate pre-coated with non-diluted Cultrex reduced growth factor base membrane extract (RGF-BME) (R&D Systems). The images of the network structure were captured by IncuCyte S3 real-time imager every 2 h at 4X magnification ...
-
bioRxiv - Microbiology 2024Quote: ... and were differentiated into monocyte-derived macrophages (MDMs) by stimulation with 20 ng/mL macrophage colony-stimulating factor (M-CSF) (R&D Systems). MDMs were cultured in Roswell Park Memorial Institute (RPMI ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were stained with ITGB4 antibody conjugated to Alexa Fluor® 488 (5 μl/1 million cells) (R&D Systems, Minneapolis, MN, USA) and Propidium Iodide Ready Flow™ Reagent (1 drop/1 million cells ...
-
bioRxiv - Bioengineering 2021Quote: ... 36 million cells were used for sorting with the Sertoli cell marker Thy-1 Cell Surface Antigen (THY1/CD90) using a PE-conjugated antibody for THY1/CD90 (R&D Systems, FAB2067P) and the EasySep™ Human PE Positive Selection Kit II (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: Angiogenesis secreted mediators were identified from fallopian tube secretory cells and ovarian carcinoma cells conditioned media employing the Human Angiogenesis Antibody Array (R&D systems: ARY007). ELISA was employed for the precise quantification of VEGF (R&D systems ...
-
bioRxiv - Cell Biology 2024Quote: ... Total VEGFR2 expression (0.1% Tx-100 permeabilized cells) was compared to surface level VEGFR2 (non-permeabilized cells) using a biotinylated VEGFR2 antibody (R&D Systems; BT10543). Images were collected using a W1 spinning disk confocal microscope.
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Cell Biology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 40 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 8 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... either alone or in combination with 1 μg/ml mouse IgG2 B anti-human TIGIT (R&D systems) or 1 μg/ml goat IgG anti-human TIM-3 (R&D systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant human TGFβ1 (100-B-001) and Thrombospondin-1 (3074-TH-050) were purchased from R&D Systems. Matrigel-based hydrogel culture system were employed ...
-
bioRxiv - Cancer Biology 2023Quote: ... granzyme B and IFN-γ secretion were measured using ELISA as described by the manufacturer (R&D Systems).
-
bioRxiv - Cell Biology 2021Quote: ... Spain) and supplemented with each one of the following combinations of growth factors: (i) 100 ng/ml Act A (R&D Systems, UK), (ii ...