Labshake search
Citations for R&D Systems :
4501 - 4550 of 10000+ citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... noggin (0.5 µg/ml, R&D Systems), LDN-193189 (0.5 µM ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gpx1 (Catalog no. AF3798, R&D Systems), Gpx3 (Catalog #AF4199 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP3 (R&D Systems; clone 166510), PE-H-2Kb (Biolegend AF6-88.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP2 (R&D Systems; clone 165903), PE-ULBP3 (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... centrinone was purchased from R&D systems. Methanol-free ...
-
bioRxiv - Cell Biology 2020Quote: ... 500ng/mL R-spondin1 (R&D Systems), 10ng/mL mouseFGF (Peprotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2020Quote: ... or 25μM FSK (Forskolin, R&D Systems) for 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... All cytokines were purchased from Peprotech except for IL-1β (R&D Systems).
-
bioRxiv - Cancer Biology 2022Quote: CXCL10 ELISA (no. DIP100; R&D Systems) was used on media collected from cell culture according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... + 3µM CHIR 99021 (R&D Systems, 4423) + 0.5µM LDN-193189 (Stemgent ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Cell Biology 2022Quote: ... and KU55933 (R&D systems, Abingdon, UK), NS398 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 ng/mL EGF (R&D Systems), 100 ng/mL Noggin (Peprotech) ...
-
bioRxiv - Neuroscience 2022Quote: ... HGF (294-HG-025 R&D systems), and T3.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and bead immunoassay (Luminex, R&D Systems) respectively that were used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... LEPR-PE (clone 52263, R&D Systems) CD271-APC (clone ME20.4-1.H4 ...
-
bioRxiv - Pathology 2022Quote: ... 200 ng/mL DKK1 (R&D Systems), and 20 ng/mL bFGF (Life Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... and EGF (R&D Systems; 10ng/mL) as described (27) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
-
bioRxiv - Immunology 2022Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
-
bioRxiv - Immunology 2022Quote: ... After the STOP solution (R&D system), the plates were read at multiple wavelengths (450 nm and 550 nm ...
-
bioRxiv - Immunology 2022Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...
-
bioRxiv - Immunology 2022Quote: ... TMB Color Substrate (#DY999, R&D Systems) was added 100μL/well and incubated at room temperature (RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 10% FBS (R&D Systems) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... and anti-IFN-γ (R&D Systems), anti-TNF-α (R&D Systems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and FGF7 (R&D Systems, #251-KG).
-
bioRxiv - Biophysics 2022Quote: ... Recombinant VCAM-1/human Fc chimera protein was purchased from R&D Systems (R&D Systems Cat# 862-VC-100).
-
bioRxiv - Immunology 2022Quote: ... Luminex High Performance Assays (R&D Systems) were performed ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
-
bioRxiv - Cell Biology 2022Quote: ... SB 431542 (Cat.# 1614; R&D Systems), PSB-1115 (Cat.# 2009 ...
-
bioRxiv - Cell Biology 2022Quote: ... Y-27632 (Cat.# 1254; R&D Systems), SB 431542 (Cat.# 1614 ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 ng/mL Shh (R&D systems) and 5% FBS for 14 days with media changes every seven days.
-
bioRxiv - Cell Biology 2022Quote: IL6 ELISA (R&D system, DY 406) was performed according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Mouse magnetic Luminex assays (R&D Systems) were performed on EDTA mouse plasma according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... IL-1β Quantikine kits (R&D Systems) were used ...
-
bioRxiv - Neuroscience 2021Quote: Quantikine ELISA plates (R&D Systems, UK) came pre-coated with capture antibody ...
-
bioRxiv - Immunology 2020Quote: ... 12ng/mL hIL-10 (R&D Systems) and 5ng/mL human IL-4 (Peprotech ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-MFG-E8 (R&D Systems), mouse anti-CD63 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2019Quote: Antibody Array: Proteome profiler (R&D Systems) antibody array was performed on 1ml of culture medium according to manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... rat monoclonal IgG2A (MAB5195, R&D Systems) and sheep polyclonal IgG (AF5195 ...
-
bioRxiv - Cell Biology 2021Quote: ... recombinant mouse CD40 ligand (R&D Systems), α-IgM (Southern Biotech) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1ng/ml TGF-β3 (R&D Systems), and 10μM DAPT (Tocris) ...
-
bioRxiv - Bioengineering 2019Quote: ... αMAEA (R&D Systems cat. nr. AF7288), αRanBP10 (Millipore SIGMA ...
-
bioRxiv - Neuroscience 2021Quote: ... NT3 (10 ng/μL, R&D Systems), as well as with db-cAMP (0.5 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... CD13 (0.8µg / ml, R&D Systems # AF2335), AQP4 (1:400 ...
-
bioRxiv - Neuroscience 2021Quote: ... and CNTF (R&D Systems, Minneapolis, MN), and 0.2 mg/ml ascorbic acid (Sigma) ...