Labshake search
Citations for R&D Systems :
401 - 450 of 4164 citations for Goat anti mouse HRP secondary antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Netrin1 (AF1109, R&D Systems), mouse anti-Neurofilament (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathB (R&D Systems, AF965), goat anti-CathD (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), mouse anti-LSAMP (Developmental Studies Hybridoma Bank) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), goat anti-NEGR1 (R&D Systems) ...
-
bioRxiv - Microbiology 2021Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathL (R&D Systems, AF1515), sheep anti-TREM2 (R&D Systems ...
-
bioRxiv - Systems Biology 2022Quote: ... goat anti-EGFR (AF231, R&D Systems), rabbit anti-phospho-ERK-1/2 Thr/Tyr 202/204 (9101 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-Dppa4 (R&D Systems, AF3730) 1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-DKK1 (R&D Systems, AF1765), rabbit ranti-Aldh1a2 (Abcam ab96060) ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-GPNMB (R&D Systems, AF2330), mouse anti-GAPDH (Proteintech Group ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-TRKB (R&D System, #AF1494) or anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Goat anti-CD31 (AF3628, R&D Systems) diluted 1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-MAX (AF4304, R&D systems).
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-Cathepsin D (R&D systems), guinea pig anti-VGAT (Synaptic systems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or goat anti-GFP (R&D System) overnight at 4 °C ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-CD13 (AF2335, R&D Systems), rabbit anti-Akt (9272 ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-CD31 (AF3628, R&D Systems), goat anti-CD13 (AF2335 ...
-
bioRxiv - Cell Biology 2024Quote: ... goat anti PODXL (AF1658, R&D systems). After incubation in primary antibodies ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-APP (AF1168, R&D Systems) 200 μg/mL ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-CD206 (R&D Systems AP2535); rat anti-LYVE1 (Thermo Fisher/eBioscience 14-0443-82) ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-MSX1 (R&D system AF5045), rabbit anti-ALDH1A2 (Abcam 75674 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-LYVE1 (R&D systems, AF2125) and rabbit anti-ACKR4 (PA5-33408 ...
-
bioRxiv - Immunology 2023Quote: ... goat anti-S100A8 (R&D Systems AF3059); rabbit anti-ERG (Cell Signaling Technologies 97249) ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-FoxA2 (AF2400, R&D Systems). Sections were washed ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-Sox2 (R&D Systems, AF2018), chicken anti-Nestin (aves ...
-
bioRxiv - Immunology 2023Quote: ... Goat Polyclonal anti-VEGFR3 (R&D Systems), Rabbit Monoclonal anti-mouse Vimentin (EPR3776 ...
-
bioRxiv - Neuroscience 2023Quote: ... Goat anti-GFRα2 (R&D Systems, #AF429), goat anti CGRP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-CathL (R&D Systems, AF1515), mouse anti-Ankyrin-G clone N106/36 (NeuroMab ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-NRP2 (R&D Systems, AF2215), 1:40 dilution ...
-
bioRxiv - Physiology 2024Quote: ... goat anti-VLDLR (R&D Systems AF2258), was used in a dilution of 1 ...
-
Emerging cooperativity between Oct4 and Sox2 governs the pluripotency network in mouse early embryosbioRxiv - Developmental Biology 2024Quote: ... goat anti-Sox17 (AF1924, R&D Systems), 1:1000 of 0.2 mg/ml.
-
bioRxiv - Cancer Biology 2024Quote: ... goat anti-AXIN1 (R&D systems, AF3287), rabbit anti-AXIN1 (Cell signaling ...
-
bioRxiv - Cell Biology 2024Quote: ... goat anti-PDX1 (AF2419, R&D Systems), mouse anti-SOX17 (MAB1924 ...
-
bioRxiv - Cell Biology 2024Quote: ... goat anti-NANOG (AF1997, R&D Systems), rabbit anti-Lefty (ab22569 ...
-
bioRxiv - Cell Biology 2024Quote: ... Goat polyclonal anti-CD31 (R&D systems) was prepared in blocking buffer and incubated with the corneas overnight ...
-
bioRxiv - Developmental Biology 2024Quote: ... goat anti-GATA6 (R&D System, AF1700), rabbit anti-YAP1 (Cell Signaling Technology ...