Labshake search
Citations for R&D Systems :
351 - 400 of 3316 citations for Cell Division Cycle 2 Like Protein Kinase 6 CDC2L6 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Nanoparticle-delivered TLR4 and RIG-I agonists enhance immune response to SARS-CoV-2 subunit vaccinebioRxiv - Immunology 2022Quote: ... there were six mice per treatment and control group for a total of 78 mice in thirteen groups: (A) Seven vaccine groups included 1 μg of unformulated SARS-CoV-2 spike protein (R&D Systems, Cat# 10549-CV-100) delivered with adjuvanted NPs ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant proteins were separately preincubated with neuronal cultures and recombinant tau protein for 3 hours prior to incubation of neuronal cultures with the mixer containing recombinant proteins (100nM Human LRP-1 Cluster IV Fc Chimera Protein; 10nM Human LRPAP Protein [R&D systems]). For pharmacological treatments ...
-
bioRxiv - Cell Biology 2020Quote: Supernatant of confluent pulmonary endothelial cells were analyzed for TNF-α and IL-6 by using a mouse-specific ELISA from R&D Systems (Minneapolis, MN, USA) according to manufacturer’s protocol with the help of an Infinite M200 PRO plate reader (TECAN Instruments ...
-
bioRxiv - Molecular Biology 2020Quote: ... the quantity of IL-2 released by Jurkat-CD16 cells was measured in the cell supernatant by colorimetry using a human IL-2 DuoSet ELISA DY202-05 Kit (R&D Systems, Minneapolis, MN, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were incubated with anti-MHC primary antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400 ...
-
bioRxiv - Physiology 2020Quote: ... B-cells were stained using rat anti-B220/CD45R antibodies (R&D systems, Cat# MAB1217)
-
bioRxiv - Genomics 2021Quote: ... Cells were then incubated in primary antibodies (SOX17-R&D Systems, AF1924, SOX2-Millipore, ab5603) diluted at 1:500 in 2% horse serum ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated with anti-MHC antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400) ...
-
bioRxiv - Immunology 2023Quote: ... cells were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Immunology 2023Quote: ... and 50 U/mL Interleukin-2 (IL-2, R&D Systems). Pre-isolated NK cells were thawed and co-cultured at a 1:1 effector:target (E:T ...
-
bioRxiv - Cell Biology 2022Quote: ... Type 2 (BME-2) droplets (R&D Systems, Minneapolis, MN, USA) and covered under medium ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Human ACE2 Biotinylated Antibody (Cat # BAF933) and Recombinant Spike S1 RBD protein (Cat # NBP2-90982) were obtained from R&D Systems (Minneapolis, MN, 55413) and NOVUS Biologicals (Centennial ...
-
bioRxiv - Cancer Biology 2022Quote: ... +/-1 µg/mL anti-CD28 (CD28.2) antibody (eBioscience/Thermo 16-0289-81) or recombinant human CD58-Fc chimera protein (R&D Systems 10068-CD-050) at 37 ºC for 2 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were embedded in Cultrex® RGF BME Type 2 (cat no. 3533-005-02, R&D systems) and placed in a 37°C incubator for 20 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse tumors were homogenized with a tissue homogenizer in 700μL of Cell Lysis Buffer 2 (R&D Systems) containing 1x Halt Protease Inhibitor Cocktail (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were maintained in proliferating state using 10 ng/ml fibroblast growth factor 2 (FGF2; R&D Systems) and passaged twice before usage in the experiments ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were grown in DMEM/F12 (HyClone, SH30023.02) supplemented with 2 %v/v N21 (R&D system, AR008), 20 ng/mL EGF (R&D system ...
-
bioRxiv - Immunology 2022Quote: ... cells were cultured in the presence of IL-2 (5 ng/ml; R&D Systems, Minneapolis, MN, USA), and in the presence or the absence of CH-223191 or FICZ ...
-
bioRxiv - Cancer Biology 2022Quote: ... Control or shLATS1/2 cells were counted and resuspended in 1% methylcellulose medium (R&D system Cat. # HSC001) prepared in complete growth medium ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were stimulated with 2 ng/mL recombinant human TGF-β1 (R&D Systems, cat. # 240-B) diluted in starvation medium for varying durations of 30 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 3 µg/mL anti-ULBP2/5/6 (clone 165903, R&D Systems), and 6 µg/mL anti-ULBP3 (clone 166510 ...
-
bioRxiv - Neuroscience 2021Quote: ... t-PA + plasminogen (R&D Systems, UK; 6, 12 or 120 nM) or without proteases for 15 minutes at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... IL-6 (25ng/mL) and IL-23 (20ng/mL, R&D Systems). For Th1 differentiation cultures ...
-
bioRxiv - Immunology 2021Quote: ... IL-6 (1000 U/mL; R&D Systems Cat# 206–1 L), and PGE2 (2 μM ...
-
bioRxiv - Genomics 2022Quote: ... and IL-6 (10ng/mL; R&D Systems Cat. 406-ML-005) at 37°C for 2 hours.
-
bioRxiv - Molecular Biology 2023Quote: ... An ELISA kit was used to measure IL-6 (R&D Systems) and we performed experiments following the manufacturer’s instructions.
-
bioRxiv - Evolutionary Biology 2024Quote: ... and IL-6 release using Mouse DuoSet ELISA kits (R&D Systems, Minneapolis ...
-
bioRxiv - Bioengineering 2023Quote: ... either 5μg or 2.5μg of the S protein or NC protein (R&D Systems, cat# 10474-CV-050 and cat# 10549-CV-100) ...
-
bioRxiv - Immunology 2022Quote: ... were incubated for 30 min at 20°C in 50 μl RPMI-HEPES in the absence of BCS with 2 μg/ml anti-ACE2 antibody (R&D Systems, #AF933) (Hoffmann et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... 2) anti-CD31 antibodies (#550274, BD Biosciences, San Jose, CA, USA; #ab28364, Abcam, Cambridge, MA, USA; #BBA7, R&D systems, Minneapolis, MN, USA); 3 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies (DCX, Goat anti-doublecortin, 1:500, Santa Cruz; SOX2, Goat anti-sex determining region Y-box 2, 1:200, R&D Systems; CLR ...
-
bioRxiv - Neuroscience 2023Quote: ... 3mg of nuclear lysates were used for IP with 2 μg IgG or 5 μg primary antibodies (normal mouse IgG, Santa Cruz Biotechnology, sc-2025; normal rabbit IgG, R&D Systems, AB-105-C ...
-
bioRxiv - Cancer Biology 2019Quote: ... Cells were stained with ITGB4 antibody conjugated to Alexa Fluor® 488 (5 μl/1 million cells) (R&D Systems, Minneapolis, MN, USA) and Propidium Iodide Ready Flow™ Reagent (1 drop/1 million cells ...
-
bioRxiv - Bioengineering 2021Quote: ... 36 million cells were used for sorting with the Sertoli cell marker Thy-1 Cell Surface Antigen (THY1/CD90) using a PE-conjugated antibody for THY1/CD90 (R&D Systems, FAB2067P) and the EasySep™ Human PE Positive Selection Kit II (STEMCELL Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: Angiogenesis secreted mediators were identified from fallopian tube secretory cells and ovarian carcinoma cells conditioned media employing the Human Angiogenesis Antibody Array (R&D systems: ARY007). ELISA was employed for the precise quantification of VEGF (R&D systems ...
-
bioRxiv - Cell Biology 2024Quote: ... Total VEGFR2 expression (0.1% Tx-100 permeabilized cells) was compared to surface level VEGFR2 (non-permeabilized cells) using a biotinylated VEGFR2 antibody (R&D Systems; BT10543). Images were collected using a W1 spinning disk confocal microscope.
-
bioRxiv - Plant Biology 2019Quote: ... DuoSet IC ELISA kit (DYC1767-2 and DYC1766-2, R&D Systems) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... and 2 ng/ml IL-2 (carrier-free; Tocris R&D Systems). Cells treated with only these functioned as the mock control ...
-
bioRxiv - Zoology 2022Quote: ... The transfected cells were cultured in iPSC medium with 200 ng/mL of recombinant viral B18R protein (R&D Systems). B18R was removal once the transfected cells were ready to re-seed onto irradiated MEFs.
-
bioRxiv - Immunology 2024Quote: ... Cells were treated with fresh A549 media with or without human IFN-β recombinant protein (R&D Systems™ 8499IF010) at the indicated concentrations ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Bioengineering 2023Quote: ... B cell activating medium was supplemented with 5 ug/mL anti-CD40 antibody (R&D systems) and 20 ng/mL IL-4 (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 40 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Immunology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 8 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... washed in PBS and resuspended in FACS buffer containing Human Fibroblast Activation Protein alpha PE-conjugated Antibody (FAP-PE) (R&D systems FAB3715P, Clone # 427819) on ice in darkness for 30min ...
-
bioRxiv - Immunology 2022Quote: ... T cells then were washed and further incubated with recombinant human IL-2 (10 ng/ml; R&D systems) for up to 2 weeks at 37°C incubator with medium change every 3 days ...
-
bioRxiv - Cell Biology 2020Quote: ... Autophagy was induced by treating the cells for 2 hours in 250nM Torin-1 (R&D Systems, 4247/10) in 1X Hanks’ Balanced salt solution ...