Labshake search
Citations for R&D Systems :
351 - 400 of 3435 citations for Anti Rat IgG H+L Antibody Conjugated to HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... slides were blocked with normal donkey serum and incubated with primary antibodies against LGR5 (rat, R&D Systems) and IL-38 (rabbit ...
-
bioRxiv - Cell Biology 2023Quote: ... Anti-VE-cadherin antibody (AF1002) and anti FOXF1 antibody (AF4798) were purchased from R&D system) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Anti-Dig-POD antibody (1:100) and primary antibody (anti-Otx2, R&D Systems, Cat#: AF1979) in 100 µl of TNB were added to samples ...
-
bioRxiv - Cell Biology 2024Quote: ... Anti-VE-cadherin antibody (AF1002) and anti FOXF1 antibody (AF4798) were purchased from R&D system. Anti S1PR1 antibody was from Sigma-Aldrich (SAB4500687 ...
-
bioRxiv - Biochemistry 2020Quote: ... These studies used Alexa-647 conjugated anti-ACE2 (MAB9332, R&D systems) and anti-RBD (Sino Biologicals ...
-
bioRxiv - Bioengineering 2022Quote: ... or Alexa Fluor™ 488-conjugated anti-human laminin (R&D Systems) to image the cell surface and DAPI (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... LEPR staining was performed using biotin-conjugated anti-LEPR (R&D systems) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were preincubated for 10min with 30µg rat anti-human neuropilin1 Fc chimera (R&D System) or 20µg goat anti-human neuropilin2 Fc chimera (R&D System ...
-
bioRxiv - Cell Biology 2024Quote: ... mouse anti-RIPK1 (clone 334640; RRID:AB_2253447; 0.5g/L; R&D Systems Cat#MAB3585), rabbit anti-RIPK1 (clone D94C12 ...
-
bioRxiv - Immunology 2022Quote: ... anti-ST6Gal1 antibody (R&D Systems) labelled with AF647 using a ThermoFisher Protein Labelling Kit (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... anti-Sox17 antibody (R&D System), anti-Brachyury antibody (Cell Signaling Technology ...
-
bioRxiv - Immunology 2024Quote: ... Anti-histidine antibody (R&D Systems) was covalently immobilized on a CM5-S sensor chip flowcell (Fc2 ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were resuspended in an antibody solution containing 5μL DYKDDDDK Epitope Tag Alexa Fluor 647-conjugated Antibody (R&D Systems #IC8529R) and 45μL DBPS + 10% FBS and incubated in the dark at room temperature for one hour ...
-
bioRxiv - Developmental Biology 2021Quote: ... which was incubated with goat anti-h/m GLI3 (1:500, R&D Systems #AF3690) and mouse anti-β-Actin antibody (1:15000 ...
-
bioRxiv - Developmental Biology 2020Quote: ... which was incubated with goat anti-h/m Gli3 (1:500, R&D Systems #AF3690) and mouse anti-β-Actin antibody (1:15000 ...
-
bioRxiv - Neuroscience 2021Quote: ... The cells were immunostained with rat anti-GFP (1:2000, GF090R; Nacalai Tesque) and goat anti-TrkB (1:250, AF1494; R&D Systems). Cells were extensively washed and incubated with appropriate secondary antibodies at 4°C overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse or rat collagen I (human, R&D Systems; mouse, Ray Biotech; rat, Yo Protein) or collagen III (human ...
-
bioRxiv - Systems Biology 2021Quote: ... and PE-conjugated antibodies against the following human proteins were obtained from R&D systems: TNFR1 (FAB225P) ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... or CD31/PECAM-1 Alexa Fluor 488-conjugated Antibody (1:200; R&D system #FAB3628G). After primary antibody incubation ...
-
bioRxiv - Microbiology 2021Quote: ... cells were then stained with secondary donkey anti-goat IgG (PE, R&D Systems) for 30 min at 4 ºC ...
-
bioRxiv - Immunology 2024Quote: ... Cryosections were stained with a monoclonal rat IgG2a anti-mouse NKp46/NCR1 (R&D Systems, clone # 29A1.4) and revealed using a donkey AF568-conjugated anti-rat pAb (Abcam) ...
-
bioRxiv - Cell Biology 2024Quote: ... and rat anti-laminin alpha 1 / beta 1 mAb (1:100) (R&D Systems, Minneapolis, MN, USA) was used for the primary antibody ...
-
bioRxiv - Cancer Biology 2021Quote: ... and goat polyclonal anti-p53-HRP at a 1:3,000 dilution (HAF1355 from R&D systems). All blots were developed using KwikQuant Ultra Digital-ECLTM Substrate Solution and processed using KwikQuantTM Imager (Kindle Bioscience LLC) ...
-
bioRxiv - Cell Biology 2021Quote: ... Bound antibody was detected using peroxidase-conjugated secondary antibodies (Sigma-Aldrich Company Ltd, Poole, U.K. and R&D Systems Ltd., Abingdon, U.K.) in conjunction with enhanced chemiluminescence detection reagents (Perbio Science Ltd. ...
-
bioRxiv - Immunology 2022Quote: ... then stained with biotinylated anti-lineage antibody cocktail and anti-c-Kit antibody (#AF 1356; R&D Systems), or anti-FcγR-AlexaFluor 647 (#101314 ...
-
bioRxiv - Immunology 2023Quote: ... anti-VEGF and anti-TGF-β detection antibodies (R&D Systems) diluted in BSA 1% (1:1000) ...
-
bioRxiv - Immunology 2023Quote: ... Antibodies were anti-IL-1b antibody (BAF401, R&D Systems, 1:1,000). DRAQ5 was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hDDP4 antibody (R&D Systems) (both antibodies were prepared in OptiMEM medium to the given concentrations) ...
-
bioRxiv - Immunology 2022Quote: ... goat anti-ACE2 antibody (R&D Systems) and Alexa Flour 647-conjugated anti-goat IgG antibody (Abcam ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti-Wnt5a antibody (MAB6452, R&D systems) or anti-Wnt11 antibody (ab31962 ...
-
bioRxiv - Cell Biology 2024Quote: Anti-CCL14 Antibody (R&D Systems, USA) was added to the sections and incubated overnight at 4°C ...
-
bioRxiv - Biophysics 2024Quote: ... Anti-HIS antibody (R&D systems, BAM050) coated polystyrene beads were prepared as previously described.39 The beads were decorated with native purified Dsn1-6HIS-3Flag kinetochores ...
-
bioRxiv - Cancer Biology 2024Quote: ... anti-IFNɣ neutralizing antibody (R&D Systems) was titrated into 806 conditioned media starting at 50 µg/mL with 10 serial 3-fold dilutions down to 0.85 ng/mL ...
-
bioRxiv - Immunology 2023Quote: ... anti-CD86 and anti-CD206) except for anti-TF antibody (AF3178; R&D Systems). Cell viability was measured using the LIVE/DEAD™ Fixable Aqua Dead Cell Stain Kit (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rat IL-6 DuoSet ELISA (DY506) and Rat IL-1β DuoSet ELISA (DY501) (R&D Systems), and Human IL-1β DuoSet ELISA (DY201 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lyve1 (rat, R&D Systems, MAB2125), E-cadherin (mouse ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Human/Mouse ROR gamma t/RORC2/NR1F3 PE-conjugated Antibody (1:10, IC6006P, R&D Systems), and Human/Mouse/Rat FoxP3 PE-conjugated Antibody (1:10 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Synthetic Biology 2024Quote: Confocal microscopy images and flow cytometry assays were recorded by Nikon confocal laser scanning microscope His Tag Alexa Fluor® 488-conjugated Antibody (IC0501G, R&D Systems), V5 Tag Monoclonal Antibody (451098 ...
-
bioRxiv - Immunology 2023Quote: ... CD4 and CD8A hispid cotton rat (Sigmodon hispidus) sequences were taken from commercially available constructs (Cotton Rat CD4 VersaClone cDNA, cat# RDC1063, R&D Systems; Cotton Rat CD8 alpha (AAL55392) VersaClone cDNA ...
-
bioRxiv - Pathology 2022Quote: ... and PE-conjugated anti-Tissue Factor/CD142 (R&D Systems, polyclonal, #FAB3178P, 1/50).
-
bioRxiv - Developmental Biology 2022Quote: ... the dissociated cells were stained with APC-conjugated anti-human DLK1 (R&D systems). Cells stained with the cell surface marker and those expressing NT were sorted using FACSAria Fusion (BD Biosciences ...
-
bioRxiv - Cancer Biology 2024Quote: ... Staining was completed with EphA2-PE (anti-mEphA2 PE conjugated R&D Systems #FAB639P). Flow cytometry was completed using the Sony MA900 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... HRP-streptavidin (R&D Systems) was added to each well ...
-
bioRxiv - Pathology 2021Quote: ... Slides from paraffin-embedded sections were H&E stained or immunostained with antibodies for: VEGFR3 (R&D Systems, AF743) or CCL21 (R&D Systems ...
-
bioRxiv - Cancer Biology 2021Quote: ... the anti-TIM3 antibody (1:1,000, AF2365 goat monoclonal antibody, R&D Systems) was detected using the Opal 540 fluorophore (1:50 ...
-
bioRxiv - Microbiology 2021Quote: ... Primary antibodies consisted in the human anti-spike mAb 48 (1:1,000; a gift from H. Mouquet) or the mouse anti-p24 Gag MAB7360 (R&D Systems; 1:1000). Anti-human or mouse IgG secondary antibodies ...