Labshake search
Citations for R&D Systems :
3601 - 3650 of 4388 citations for Mouse Anti Hantavirus Nucleocapsid Protein Antibody 4956 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... 50μl of mitochondria (1μg/μl protein) were treated with Caspase-8-cleaved tBid from 5-500nM (882-B8-050, R&D Systems, Minneapolis, MN), Bim-BH3 from 10-10,000nM (Ac-DMRPEIWIAQELRRIGDEFNAYYARR-amide ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2014) has a 42% sequence identity and 58% sequence similarity with the recombinant zebrafish BMP4 protein (R&D Systems, cat. 1128-BM-010) used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Presence of 105 proteins in supernatants was evaluated using human cytokine and chemokine XL proteome array kit from R&D Systems (Minneapolis, MN).
-
bioRxiv - Neuroscience 2022Quote: ... progranulin concentrations were determined in duplicate using 10–15 μl of lysates per well (typically 8–20 μg of total protein per well) using a sandwich ELISA assay (R&D Systems, DPGRN0). For experiments analyzing secreted progranulin ...
-
bioRxiv - Immunology 2021Quote: The expression of NKG2D ligands in tumor cell lines was assessed using Recombinant Human NKG2D Fc Chimera Protein (R&D systems, Abingdon, UK). 105 tumor cells were incubated either with 0.5 μg of NKG2D Fc recombinant protein or IgG1-Fc during 30 min ...
-
bioRxiv - Microbiology 2021Quote: Sterile tissue culture plates were coated overnight at 4°C with 5 µg/mL recombinant CD62P protein (R&D Systems, #137-PS-050). The following day the wells were washed 3X with PBS before being blocked with 1% BSA in PBS at room temperature (RT ...
-
bioRxiv - Neuroscience 2022Quote: ... A subset of slices were infected with only AAV9.hsyn.GFP and at DIV6 were treated with human Sema4D-Fc ectodomain/human Fc fusion protein (Sema4D-Fc; R&D Systems, #7470-S4) or Fc control protein (R&D Systems ...
-
bioRxiv - Genomics 2022Quote: Circulating AAV-expressed human ANGPTL3 protein levels were measured from plasma using commercially-available ELISA kits (plasma diluted 1:4 and used with R&D Systems #DANL30). The assay is specific for detection of human ANGPTL3 protein ...
-
bioRxiv - Microbiology 2022Quote: ... The HA remaining after supernatant-driven degradation was detected with HA binding protein following dilutions and instructions in the Hyaluronan DuoSet ELISA kit by R&D Systems (DY3614). As was the case for fibronectin and laminin ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were left for 48h to allow expression of LepRb-HA protein before treatment with recombinant murine leptin (R&D System #498-OB) at 0-10 ng/L for 30 minutes before cell lysis and western blotting for phosphoSTAT3 (Y705) ...
-
bioRxiv - Systems Biology 2023Quote: Where indicated the cells were stimulated with the final concentration of 10 ng/ml of recombinant human TNF-α protein (R&D Systems) or 100 ng/ml of recombinant human interleukin 1 beta (IL-1β ...
-
bioRxiv - Biochemistry 2023Quote: ... and 250 μg of protein from each condition was incubated with a membrane array from the Proteome Profiler Human XL Cytokine Array Kit (R&D Systems, ARY022B). Membranes were processed according to the manufacturer’s instructions and imaged using an ImageQuant LAS 4000 (GE Healthcare) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Subsequently cell clusters were differentiated into β-like cells by exposure to the appropriate media as previously published.29 All recombinant proteins were purchased from R&D System unless otherwise stated (see Supplementary Table 3).
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies targeting the following proteins were used at the indicated dilutions and obtained from the denoted companies: Robo3 1:300 (R&D systems, #AF3155), GluN1 NMDAR 1:1000 (SySy #114011) ...
-
bioRxiv - Bioengineering 2023Quote: ... The relative expression levels of apoptosis related proteins of post I/RI iCMs (n=3) were analyzed using the Proteome Profiler Human Apoptosis Array (R&D Systems, #ARY009), according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... ciCMVEC were placed in serum-free media 1h before treatment with 10 ng/ml of Recombinant Human TNF-α Protein (210-TA-005; R&D systems) or vehicle (PBS ...
-
bioRxiv - Cell Biology 2024Quote: Secreted proteins were measured in cell culture supernatants from treated iBMDMs using ELISAs for IL-1β and CCL5 (Quantikine®, R&D systems).
-
bioRxiv - Bioengineering 2024Quote: ... IDUA activity was assessed using 4-methylumberlliferyl-alpha-L-iduronide (Glycosynth, Cheshire, England) and recombinant human alpha-L-iduronidase protein (R&D systems, Minneapolis) following manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... The supernatant was collected at indicated times and protein concentrations were determined by ELISA following the manufacturer’s instructions for IL-6 (R&D systems, DY406-05), TNFα (R&D systems ...
-
bioRxiv - Neuroscience 2024Quote: Secreted proteins in iTF-Microglia conditioned media were measured using the Proteome Profiler Human Cytokine Array Kit (R&D Systems; Cat. No. ARY005B) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2019Quote: ... TIM-3-Alexa Fluor 488 (344823) and TIGIT-APC (741182) antibodies (all from R&D Systems); CD4-APC-H7 (L200) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: ... and incubated overnight with primary antibodies PDGFRa (1:1000, AF-307-NA, R&D Systems, USA), Collagen 1 (Cat nb ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...
-
bioRxiv - Physiology 2019Quote: ... Measurements were undertaken with antibodies & standards from R&D Systems (R&D Systems Europe, Abingdon UK) using a microtiter plate-based two-site electrochemiluminescence immunoassay using the MesoScale Discovery assay platform (MSD ...
-
bioRxiv - Cell Biology 2019Quote: ... Following antibodies were used in this study to recognize Havcr1 (R&D Systems AF1817, 1:500), LTL (Vector Laboratories FL-1321 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A working concentration of 1 μg/ml human ACE2 biotinylated antibody (R&D Systems, Minneapolis, MN) was prepared ...
-
bioRxiv - Physiology 2022Quote: Cryosections were stained with primary antibodies to detect CD64 (R&D Systems, Minneapolis, MN, USA #AF2074), and subsequently stained with secondary antibodies conjugated to either Alexa fluor 568 (donkey anti-goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were stained using a primary antibody raised against TNR (1/50, AF3865, R&D systems) and secondary antibody conjugated to Rhodamine Red-X raised against goat IgG (1/100 ...
-
bioRxiv - Physiology 2023Quote: ... Sections were then stained overnight at 4°C using primary antibody for SOX9 (R&D Systems) or phosphor-EGFR (phosphoTyr-1173 ...
-
bioRxiv - Immunology 2022Quote: ... The appropriate HRP-conjugated secondary antibodies were used at 1:5000 (1:5000; R&D Systems). For a detailed list of reagents ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated for 1 h with an antibody raised against decorin69 or VEGFR3 (R&D systems). HRP-conjugated secondary antibody was incubated for 1 h and the immune complexes were revealed using SIGMA-FAST TM O-phenylenediamine dihydrochloride (P9187) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human VEGFR3/Flt-4 antibody (1:500, AF743) was obtained from R&D systems (Minneapolis, MN). Horse Radish Peroxidase (HRP ...
-
bioRxiv - Genomics 2023Quote: ... membranes were probed overnight at 4°C with antibodies that recognize ERAP2 (AF3830, R&D Systems) or α-tubulin (T9026 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added overnight at 1:100 for CD31 (AF3628, R&D Systems, Minneapolis, USA), 1:500 dilution for Iba1 (ab5076 ...