Labshake search
Citations for R&D Systems :
3201 - 3250 of 3999 citations for Mouse Anti Hepatitis A Virus Antibody 1887 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Cells were treated with media containing recombinant mouse transforming growth factor-beta 1 (rmTGFβ1) at 5ng/mL (R&D systems, 7666-MB) or normal media ...
-
Beclin1-Deficient Adipocytes Promote Tumor Progression by YAP/TAZ-dependent Adipocyte TransformationbioRxiv - Biochemistry 2023Quote: ... The levels of adipokines in the plasma of WT and BaKO mice were measured using the Mouse Adipokine Array Kit (ARY013; R&D Systems) and LEGENDplex (740929 ...
-
bioRxiv - Molecular Biology 2023Quote: The cells were seeded in duplicates at 5x103 in 1 ml of mouse methylcellulose complete media without Epo (HSC008; R&D Systems) containing mIL-3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... IL-1β and other pro-inflammatory cytokine levels in mouse BM and plasma were measured by ELISA kits from R&D systems and Mesoscale Discovery according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Neutrophil specific elastase was quantified using the Mouse Neutrophil Elastase/ELA2 DuoSet ELISA kit and the DuoSet Ancillary Reagent Kit2 (both from R&D Systems). Cecal pathology was scored at necropsy ...
-
bioRxiv - Immunology 2022Quote: Llamas were immunized intramuscularly once per week over six weeks with carrier free recombinant human IL-9 or mouse IL-9 (R&D Systems). Each llama (4 in total ...
-
bioRxiv - Developmental Biology 2023Quote: ... embryonic NSC media was prepared as above without epidermal growth factor and with the addition of 50 ng/mL mouse bone morphogenetic protein 4 (R&D Systems, 5020-BP-010 ...
-
bioRxiv - Physiology 2023Quote: Circulating TNFR1 and TNFR2 were measured in human or mouse samples using enzyme-linked immunosorbent assay (ELISA) kits (DY255, DY726, DY425 and DY426 respectively, all from R&D Systems) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... The amount of CXCL1 or CXCL2 protein in the supernatant was determined using a mouse CXCL1 or CXCL2 specific ELISA kit (R&D system). All experiments were performed according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... The levels of mouse IL-5 and IL-13 were measured with DuoSet ELISA kits (DY405 and DY413 respectively, R&D Systems). Mouse IL-33 was quantified by ELISA Kit (Cat# 88-7333-22 ...
-
bioRxiv - Bioengineering 2024Quote: ... we used both mouse (111 analytes) and human (105 analytes) proteome profiler XL kits (R&D Systems, Cat No. ARY028 and ARY022B). We screened the cell culture supernatant from Day 7 spheroid cultures with and without SIS ECM ...
-
bioRxiv - Cell Biology 2023Quote: ... Cytokine levels in BMEF were then measured using mouse CXCL12/SDF-1 alpha (MCX120) and SCF (MCK00) Quantikine ELISA kits (R&D Systems) according to the manufacturer’s protocols.
-
bioRxiv - Cell Biology 2024Quote: Extracellular conditioned media from differentiated 3T3-L1 cells pretreated with or without palmitate and UNC0642 were quantified using mouse IL-6 Quantikine ELISA kit M6000B from R&D Systems as per the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... the concentration of IL-17A in the culture supernatant was quantified using the Mouse IL-17 DuoSet ELISA kit (R&D Systems) in accordance with the manufacturer’s directions.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Naïve T cells were isolated by negative selection using a Mouse Naive T Cell CD4+/CD62L+/CD44low Column Kit (R&D Systems). Naïve CD4 T cells were treated with fluorescein isothiocyanate-labeled (FITC ...
-
bioRxiv - Cell Biology 2024Quote: ... cultures were exposed for the duration of treatment with either 100ng/mL recombinant mouse Sfrp2 (R&D Systems Cat 1169-FR-025) or vehicle control (PBS with 0.1% BSA).
-
bioRxiv - Cell Biology 2024Quote: ... overexpressed with or without V5-mEHMT1 and pretreated with or without palmitate and UNC0642 were quantified for 38 different adipokines using Proteome Profiler Mouse Adipokine Array Kit ARY013 from R&D Systems as per the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... or various doses (100 ng/mL, 200 ng/mL, 400 ng/mL) of recombinant mouse IGF-1 (catalog #: 791-MG-050; R&D Systems) for 24 hours ...
-
bioRxiv - Cancer Biology 2024Quote: A pool of plasma from 2 to 4 mice was loaded on the membrane of the Proteome Profiler Mouse XL cytokine Array (ARY028, R&D systems) following manufacturer’s recommendations ...
-
bioRxiv - Synthetic Biology 2024Quote: ... IL-6 and BNP plasma levels were analyzed using the following ELISA kit: Mouse IL-6 Quantikine ELISA Kit (M6000B, R&D systems), Mouse BNP EIA (EIAM-BNP-1 ...
-
bioRxiv - Physiology 2024Quote: ... 118.62 ng/ml; human, 50 ng/ml), and TNFα 1000U (mouse, 3.7 ng/ml; human, 13.15 ng/ml) (R&D Systems, Minneapolis, MN) or vehicle (0.1% PBSA ...
-
bioRxiv - Developmental Biology 2023Quote: ... CDX2-88), anti-Nanog rabbit IgG (Cosmo Bio, Tokyo, Japan, cat. no. REC-RCAB0002P-F) and anti-Sox17 goat IgG (R&D Systems, cat no. AF1924) in dilutions of 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were washed and blocked in PBS with 2% donkey serum and 2% bovine serum albumin for an hour and incubated with rabbit anti-IBA1 (WAKO, cat#019-19741, RRID:AB_839504, 1:500) and goat anti-GPNMB (R&D Systems, cat#AF2550, RRID:AB_416615, 3µg/ml) primary antibodies in PBS with 2% donkey serum overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2019Quote: ... TIM-3-Alexa Fluor 488 (344823) and TIGIT-APC (741182) antibodies (all from R&D Systems); CD4-APC-H7 (L200) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: ... and incubated overnight with primary antibodies PDGFRa (1:1000, AF-307-NA, R&D Systems, USA), Collagen 1 (Cat nb ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...
-
bioRxiv - Physiology 2019Quote: ... Measurements were undertaken with antibodies & standards from R&D Systems (R&D Systems Europe, Abingdon UK) using a microtiter plate-based two-site electrochemiluminescence immunoassay using the MesoScale Discovery assay platform (MSD ...
-
bioRxiv - Cell Biology 2019Quote: ... Following antibodies were used in this study to recognize Havcr1 (R&D Systems AF1817, 1:500), LTL (Vector Laboratories FL-1321 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A working concentration of 1 μg/ml human ACE2 biotinylated antibody (R&D Systems, Minneapolis, MN) was prepared ...
-
bioRxiv - Physiology 2022Quote: Cryosections were stained with primary antibodies to detect CD64 (R&D Systems, Minneapolis, MN, USA #AF2074), and subsequently stained with secondary antibodies conjugated to either Alexa fluor 568 (donkey anti-goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were stained using a primary antibody raised against TNR (1/50, AF3865, R&D systems) and secondary antibody conjugated to Rhodamine Red-X raised against goat IgG (1/100 ...
-
bioRxiv - Physiology 2023Quote: ... Sections were then stained overnight at 4°C using primary antibody for SOX9 (R&D Systems) or phosphor-EGFR (phosphoTyr-1173 ...
-
bioRxiv - Immunology 2022Quote: ... The appropriate HRP-conjugated secondary antibodies were used at 1:5000 (1:5000; R&D Systems). For a detailed list of reagents ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated for 1 h with an antibody raised against decorin69 or VEGFR3 (R&D systems). HRP-conjugated secondary antibody was incubated for 1 h and the immune complexes were revealed using SIGMA-FAST TM O-phenylenediamine dihydrochloride (P9187) ...