Labshake search
Citations for R&D Systems :
3101 - 3150 of 10000+ citations for D Iditol 1 13C since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... IL-12 from Peprotech and IL-18 from R&D systems. HODHBt was purchased from AK Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... DPT (AF4629) (R&D systems, Minneapolis, MN), and β-actin (#ab6276)(Abcam).
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: Interferon Beta (R&D systems 8499-IF) was dissolved per the manufacturer’s instructions ...
-
Abl kinase deficiency promotes AKT pathway activation and prostate cancer progression and metastasisbioRxiv - Cancer Biology 2020Quote: ... phospho-AXL Tyr779 (MAB6965, R&D Systems), chromogranin A (NB100-79914 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4-1BB (MAB9371, R&D systems) 1mg/kg was injected on days 0 and 4 through an intravenous route ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), mouse anti-LSAMP (Developmental Studies Hybridoma Bank) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-Trk-C (R&D Systems), goat anti-Plexin-A1 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-Tenascin-R (R&D Systems), sheep anti-Contactin 1 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), goat anti-NEGR1 (R&D Systems) ...
-
bioRxiv - Biochemistry 2020Quote: ... LXRα (PP-PPZ0412-00, R&D systems), LXRβ (K8917 ...
-
bioRxiv - Biochemistry 2020Quote: Anti PSMB7 (R&D Systems, Cat. #MAB7590)
-
bioRxiv - Bioengineering 2021Quote: ... washed with Permeabilization Buffer (R&D Systems), centrifuged ...
-
bioRxiv - Cell Biology 2021Quote: Human fibronectin was from R&D Systems. Coll I from calf skin was produced by Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 50 ng/mL KGF (R&D Systems), 0.25 mM ascorbic acid (Sigma).
-
bioRxiv - Cell Biology 2021Quote: ... Anti-ERK1/ERK2 (#AF1576,R&D systems), 1:500 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... CCL20 (R&D Systems Cat# AF360-SP), and/or actin (Abcam Cat# 179467 ...
-
bioRxiv - Microbiology 2020Quote: ... ADAM10 (clone 163003, R&D Systems MAB1427), CD63 (clone H5C6 ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hDDP4 antibody (R&D Systems) (both antibodies were prepared in OptiMEM medium to the given concentrations) ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hACE2 (R&D systems, AF933), respectively ...
-
bioRxiv - Systems Biology 2020Quote: ... or 30 nM HRG (R&D Systems) and incubated for 5 ...
-
bioRxiv - Neuroscience 2021Quote: ... noggin (0.5 μg/ml, R&D Systems), LDN-193189 (0.5 μM ...
-
bioRxiv - Microbiology 2021Quote: ... or α-C1s (R&D Systems, MAB2060) antibodies ...
-
bioRxiv - Developmental Biology 2020Quote: ... Olig2 (goat polyclonal, AF2418, R&D System), Pax6 (rabbit polyclonal ...
-
bioRxiv - Microbiology 2021Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
-
bioRxiv - Immunology 2020Quote: ... NKG2A AlexaFluor700 (FAB1059N) (from R&D systems). All antibodies were titrated and used at optimal dilutions prior to panel integration ...
-
bioRxiv - Immunology 2021Quote: ... anti-vimentin (R&D Systems, # MAB21052-SP), anti-ICP8 (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10% volume of resazurin (R&D Systems) was added into 96-well culture plates ...
-
bioRxiv - Systems Biology 2021Quote: ... Mouse IgG2A-488 (R&D systems, IC003G) was used an isotype control ...
-
bioRxiv - Systems Biology 2020Quote: ... GDNF (2 ng/mL, R&D Systems), NT3 (10 ng/µL ...
-
bioRxiv - Systems Biology 2020Quote: ... NT3 (10 ng/µL, R&D Systems) and the small molecules CHIR99021 (2 µM ...
-
bioRxiv - Systems Biology 2020Quote: ... noggin (0.5 µg/ml, R&D Systems), LDN-193189 (0.5 µM ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gpx1 (Catalog no. AF3798, R&D Systems), Gpx3 (Catalog #AF4199 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP3 (R&D Systems; clone 166510), PE-H-2Kb (Biolegend AF6-88.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP2 (R&D Systems; clone 165903), PE-ULBP3 (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... syndecan-2 (R&D Systems Cat#: FAB2965P), syndecan-3 (R&D Systems Cat# ...
-
bioRxiv - Cell Biology 2021Quote: ... centrinone was purchased from R&D systems. Methanol-free ...
-
bioRxiv - Cell Biology 2020Quote: ... 500ng/mL R-spondin1 (R&D Systems), 10ng/mL mouseFGF (Peprotech) ...
-
bioRxiv - Bioengineering 2020Quote: ... cleaved caspase-3 (R&D System, MAB835) (1:150 in goat serum ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2020Quote: ... or 25μM FSK (Forskolin, R&D Systems) for 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... All cytokines were purchased from Peprotech except for IL-1β (R&D Systems).