Labshake search
Citations for R&D Systems :
251 - 300 of 4178 citations for Goat Anti Human IgG Fc FITC since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... and anti-CCR7 antibodies conjugated to FITC (R&D Systems, FAB197F, lot LEU1615081) and the dilution of CellTrace Violet in CD3+CCR7- TEM cells and CD3+CCR7+ naive/TCM cells was measured by flow cytometry on a BD CantoII as quantification of cell proliferation ...
-
bioRxiv - Neuroscience 2019Quote: ... MSD GOLD 96-Well Streptavidin plates were blocked with 3% BSA and coated with a solution containing 0.25 µg/ml biotinylated polyclonal goat anti-human TREM2 capture antibody (BAF1828, R&D Systems, Minneapolis, MN). CSF and plasma samples diluted 1:4 in 1% BSA were added to the prepared plates and incubated overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... Detection of bound sIL7R was carried out by one-hour incubation at room temperature with biotinylated goat anti-human IL7R polyclonal antibody (R&D Systems, # BAF306), followed by 30-minute incubation at room temperature with streptavidin-horseradish peroxidase (Millipore Sigma ...
-
bioRxiv - Immunology 2021Quote: ... the membrane was incubated in PBS-T with 1% ELK for 45 minutes with either goat anti-human C1r (1:300, R&D Systems, AF1807), sheep anti-human C1s (1:300 ...
-
bioRxiv - Immunology 2023Quote: ... Protein concentration was measured with BCA assay and 350 µg of lysates were incubated with 5 μg of anti-Siglec-E antibody (polyclonal goat IgG - R&D Systems – cat. AF5806) or goat IgG for 2h at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human PODPCALYXIN (R&D Systems), mouse anti-human SSEA4 (R&D Systems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human SSEA4 (R&D Systems), or mouse anti-human CD9 (R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human SOX2 (R&D Systems), goat anti-human NANOG (R&D Systems) ...
-
bioRxiv - Immunology 2020Quote: ... anti-human CXCL13 (53610, R&D Systems) and GZMB (REA226 ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-human ACE2 (R&D Systems, #HK0320042), PE-labelled anti-human IgG (Southern Biotech ...
-
bioRxiv - Microbiology 2023Quote: ... and anti mouse igG (#MAB002, R&D systems). The interactions between the two labeled proteins were detected using the Duolink in Situ Red Starter Kit Mouse/Rabbit (#DUO92101-1kit ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... goat anti-NKp46 (R&D Systems, AF2225), or rat anti-Ly6G (ab2557 NMP-R14 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Tbx6 (R&D Systems, AF4744), rabbit anti-Laminin 111 which detects all laminins containing a1 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-DTR (R&D Systems AF259), rat anti-CD68 (1:200 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-SOX1 (AF3369; R&D Systems), rabbit anti-Ki67 (90584 ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Netrin1 (AF1109, R&D Systems), mouse anti-Neurofilament (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathB (R&D Systems, AF965), goat anti-CathD (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), mouse anti-LSAMP (Developmental Studies Hybridoma Bank) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), goat anti-NEGR1 (R&D Systems) ...
-
bioRxiv - Microbiology 2021Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathL (R&D Systems, AF1515), sheep anti-TREM2 (R&D Systems ...
-
bioRxiv - Systems Biology 2022Quote: ... goat anti-EGFR (AF231, R&D Systems), rabbit anti-phospho-ERK-1/2 Thr/Tyr 202/204 (9101 ...
-
bioRxiv - Cancer Biology 2019Quote: ... goat anti-CD31 (R&D System; AF3628) and anti-goat AlexaFluor594 (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147); mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147), mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Developmental Biology 2019Quote: ... Goat anti-MITF (R&D systems, AF5769) 1:100.
-
bioRxiv - Bioengineering 2019Quote: ... goat anti-CD31 (R&D Systems; AF3628), rabbit anti-activated-caspase-3 (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-Dppa4 (R&D Systems, AF3730) 1:100 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-DKK1 (R&D Systems, AF1765), rabbit ranti-Aldh1a2 (Abcam ab96060) ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-GPNMB (R&D Systems, AF2330), mouse anti-GAPDH (Proteintech Group ...
-
bioRxiv - Genomics 2021Quote: ... anti-goat-HRP (R&D systems, HAF019), anti-rabbit-HRP (GE healthcare ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-TRKB (R&D System, #AF1494) or anti-β-actin mouse monoclonal antibody (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... Goat anti-CD31 (AF3628, R&D Systems) diluted 1:300 ...
-
bioRxiv - Molecular Biology 2023Quote: ... goat anti-MAX (AF4304, R&D systems).
-
bioRxiv - Immunology 2022Quote: ... goat anti-ACE2 antibody (R&D Systems) and Alexa Flour 647-conjugated anti-goat IgG antibody (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-Cathepsin D (R&D systems), guinea pig anti-VGAT (Synaptic systems) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or goat anti-GFP (R&D System) overnight at 4 °C ...