Labshake search
Citations for R&D Systems :
2651 - 2700 of 10000+ citations for 6 Ethylthieno 2 3 d pyrimidin 4 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... anti-vimentin (R&D Systems, # MAB21052-SP), anti-ICP8 (Abcam ...
-
bioRxiv - Immunology 2021Quote: ... α- VCAM-1 (Phe25-Glu698) (R&D Systems), α-Fibroblast Marker-AF647 (ERTR7 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 10% volume of resazurin (R&D Systems) was added into 96-well culture plates ...
-
bioRxiv - Systems Biology 2021Quote: ... Mouse IgG2A-488 (R&D systems, IC003G) was used an isotype control ...
-
bioRxiv - Systems Biology 2020Quote: ... NT3 (10 ng/µL, R&D Systems) and the small molecules CHIR99021 (2 µM ...
-
bioRxiv - Systems Biology 2020Quote: ... noggin (0.5 µg/ml, R&D Systems), LDN-193189 (0.5 µM ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Neuroscience 2020Quote: ... GFRA2 (1:500; AF429, R&D Systems). Sections were then washed 3 × 10 min in MAXwash solution and incubated with secondary antibodies for 1 hr at RT ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gpx1 (Catalog no. AF3798, R&D Systems), Gpx3 (Catalog #AF4199 ...
-
bioRxiv - Neuroscience 2021Quote: ... SOX9 1:200 (R&D Systems, #AF3075), NESTIN 1:500 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP3 (R&D Systems; clone 166510), PE-H-2Kb (Biolegend AF6-88.5) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PE-ULBP2 (R&D Systems; clone 165903), PE-ULBP3 (R&D Systems ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... centrinone was purchased from R&D systems. Methanol-free ...
-
bioRxiv - Cell Biology 2020Quote: ... 500ng/mL R-spondin1 (R&D Systems), 10ng/mL mouseFGF (Peprotech) ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2020Quote: ... or 25μM FSK (Forskolin, R&D Systems) for 24 hours ...
-
bioRxiv - Immunology 2021Quote: ... All cytokines were purchased from Peprotech except for IL-1β (R&D Systems).
-
bioRxiv - Cell Biology 2021Quote: ... Gli3 (1:1000) (R&D Systems; AF3690), Cep164 (1:100 ...
-
bioRxiv - Cancer Biology 2021Quote: ... PODXL (R&D Systems #AF1658, 1:500); SIX1 (Cell Signaling #12891 ...
-
bioRxiv - Cancer Biology 2021Quote: ... NPHS1 (R&D Systems #AF4269, 1:60); PAX2 (Invitrogen #71-6000 ...
-
bioRxiv - Cancer Biology 2022Quote: CXCL10 ELISA (no. DIP100; R&D Systems) was used on media collected from cell culture according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... + 3µM CHIR 99021 (R&D Systems, 4423) + 0.5µM LDN-193189 (Stemgent ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Cancer Biology 2022Quote: ... MIF (MAB2892, R&D systems, 1:500), LTF (HPA059976 ...
-
bioRxiv - Cell Biology 2022Quote: ... and KU55933 (R&D systems, Abingdon, UK), NS398 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 ng/mL EGF (R&D Systems), 100 ng/mL Noggin (Peprotech) ...
-
bioRxiv - Developmental Biology 2022Quote: ... PDGFRA (R&D Systems, AF1062, 1:100); and Alexa Fluor-conjugated secondary goat anti-rat ...
-
bioRxiv - Neuroscience 2022Quote: ... HGF (294-HG-025 R&D systems), and T3.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and bead immunoassay (Luminex, R&D Systems) respectively that were used according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... LEPR-PE (clone 52263, R&D Systems) CD271-APC (clone ME20.4-1.H4 ...
-
bioRxiv - Pathology 2022Quote: ... 200 ng/mL DKK1 (R&D Systems), and 20 ng/mL bFGF (Life Technologies) ...
-
bioRxiv - Genetics 2022Quote: ... and EGF (R&D Systems; 10ng/mL) as described (27) ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
-
bioRxiv - Immunology 2022Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
-
bioRxiv - Immunology 2022Quote: ... After the STOP solution (R&D system), the plates were read at multiple wavelengths (450 nm and 550 nm ...
-
bioRxiv - Immunology 2022Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...
-
bioRxiv - Immunology 2022Quote: ... TMB Color Substrate (#DY999, R&D Systems) was added 100μL/well and incubated at room temperature (RT ...
-
bioRxiv - Physiology 2022Quote: ... Podocalyxin (MAB1556, R&D Systems, 1:500), TRPC6 (Alomone ACC-017 ...
-
bioRxiv - Molecular Biology 2022Quote: ... supplemented with 10% FBS (R&D Systems) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... VEGFR3 (AF743, R&D Systems, 1:150), and GFP (GFP-RB-AF2020 ...
-
bioRxiv - Developmental Biology 2022Quote: ... LYVE1 (AF2125, R&D Systems, 1:150), VEGFR3 (AF743 ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% fetal bovine serum (R&D systems), 2.5% HEPES (Corning ...
-
bioRxiv - Bioengineering 2022Quote: ... and anti-IFN-γ (R&D Systems), anti-TNF-α (R&D Systems) ...
-
bioRxiv - Bioengineering 2022Quote: ... angiopoietin-1 (ANG-1, R&D Systems) and hepatocyte growth factor (HGF ...
-
bioRxiv - Bioengineering 2022Quote: ... 1:10,000 (R&D Systems, Cat: MAB3228); anti-mouse HRP ...
-
bioRxiv - Developmental Biology 2022Quote: ... and FGF7 (R&D Systems, #251-KG).
-
bioRxiv - Biophysics 2022Quote: ... Recombinant VCAM-1/human Fc chimera protein was purchased from R&D Systems (R&D Systems Cat# 862-VC-100).
-
bioRxiv - Immunology 2022Quote: ... Luminex High Performance Assays (R&D Systems) were performed ...