Labshake search
Citations for R&D Systems :
2401 - 2450 of 3265 citations for Anti Syndecan 4 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-NRP2 (Cat#: AF567, R&D Systems, 1:20), goat anti-VEGFR3 (Cat# ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-VEGFR3 (Cat#: AF743, R&D Systems, 1:100) mouse anti-VE-cadherin (F8 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and anti-PROX1 (Cat#: AF2727, R&D Systems, 1:200).
-
bioRxiv - Immunology 2023Quote: ... or anti-TNF (1:200, R&D Systems, #AF410-NA) antibodies diluted in PBS overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... 20μg/ml human anti-IFNGR1 (clone GIR208) (R&D System) or human IgG1 (clone MOPC-21 ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse Csf2ra-Alexa 700 (clone 698423, R&D systems), or anti-mouse CD11b-BV785 (clone M1/70 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-Mertk-AlexaFluor700 (R&D Systems, FAB5912N, 1:200), and rat anti-Axl-AlexaFluor700 (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... or anti-CCR5 (5μg/ml, clone 45531, R&D Systems) blocking antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse G-CSF ELISA kit (MCS00, R&D Systems), IgE ELISA kit (company?) ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-Clusterin (1:200, R&D Systems, AF797-SP); rat anti-Cd31 (MEC 13.3 clone ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Mouse SOST/Sclerostin (R&D Systems, AF1589; 1:500), anti-Ocn (Takara ...
-
bioRxiv - Developmental Biology 2023Quote: ... Goat anti-Gli2 (R&D system; AF3635; staining 1:1000).
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-IgG (Cat # AB-105-C, R&D Systems) antibody with mouse anti-SMARCD2 (Cat # sc-101162 ...
-
bioRxiv - Developmental Biology 2023Quote: ... and rat anti-Cerberus1 (1:200, MAB1986, R&D Systems). The next day ...
-
bioRxiv - Cancer Biology 2023Quote: ... Anti-human IL-6 (AB-206-NA, R&D Systems) 10 mg/kg was administered intraperitoneally (IP ...
-
bioRxiv - Cancer Biology 2023Quote: ... or goat anti-IgG (R&D Systems #AB-1080-C) as a control antibody in the relevant reduced serum media ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti SOX1 (1:200, R&D Systems, Biotechne #AF3369) and rabbit anti-gH2A.X (1:400 ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-Rat-HRP (1:20000, R&D systems HAF005).
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-LGR5 (MAB8240SP, R&D Systems, 1:50). As secondary antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Mer tyrosine kinase (MERTK; clone #125518, R&D Systems), anti-purinergic receptor P2Y12 (P2RY12 ...
-
bioRxiv - Immunology 2023Quote: ... anti-O1(Cat#MAB1327, RRID:AB_357618, R&D System, 1:100) for mature oligodendrocytes ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-SOX9 (SOX9, 1:1000, AF3075, R&D Systems), rabbit ani-SOX9 (SOX9 ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-LAMP1-LD (R&D Systems AF4800 [1:100]). Secondary antibodies and dyes included phallodin Alexafluor 488 (Molecular Probes [1:1000]) ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti–E-cadherin (AF748, 1:5,000; R&D Systems) and rabbit anti-RFP (600-401-379 ...
-
bioRxiv - Developmental Biology 2023Quote: ... goat anti-HHIP (1:500, cat. # AF1568, R&D Systems), rabbit anti-ERG (1:500 ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-VEGFR2 (R&D systems, AF357, WB 1:1000), mouse anti-VE- cadherin-Alexa647 (BD Biosciences ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti mouse-PDGFRα (1:200 AF1062, R&D Systems), rat anti-CD68 (1:500 ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD4 (AF-379-NA, R&D Systems, MN, USA), anti-CD8 (NB100-65729 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Goat anti-PDGFRA (1:500, AF1062, R&D Systems, RRID:AB_2236897), rabbit anti-phospho-Smad1/5 (1:800 ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-NRP1 (1:500, goat polyclonal, AF566 R&D systems); anti-TLE4 (1:500 ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-PDGFRA (R&D Systems, Cat# AF1062, RRID:AB_2236897; 1/80), anti-Laminin α2 (Santa Cruz Biotechnology ...
-
bioRxiv - Bioengineering 2024Quote: ... goat anti-VIM 1:200 (R&D Systems Cat#AF2105), rabbit anti-c-KIT 1:500 (Abcam Cat#ab32363 ...
-
bioRxiv - Neuroscience 2024Quote: ... sheep anti-EOMES/TBR2 (1:250, AF6166, R&D Systems); rabbit anti-CHD3 (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-Gr1 (MAB1037-100, rat IgG; R&D Systems). After rinsing ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-MMP1 Mab 901 (R&D Systems 1:750); rabbit anti-actin (Sigma 1:1000) ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-PDGFRα (1:1000, Cat. No. AF1062, R&D Systems); polyclonal chicken ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-PTPσ (1:200; R&D Systems, Cat# AF3430), rabbit anti-VGAT (1:300 ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-CD13 (R&D Systems, AF2335; dilution 1:100), and mouse monoclonal anti-GABAB (Abcam ...
-
Localization of Cadherins in the postnatal cochlear epithelium and their relation to space formationbioRxiv - Cell Biology 2024Quote: ... goat anti-P-cadherin (1:250, AF761, R&D Systems), mouse anti-phosphoTyrosine (1:250 ...
-
bioRxiv - Immunology 2021Quote: ... 109-006-127), 250ng/ml human recombinant MEGACD40L (Enzo, ALX-522-110) and 20ng/ml Recombinant human IL-4 (R&D system, 204-IL-010). Cells were collected at specific time points for analysis.
-
bioRxiv - Bioengineering 2022Quote: Transduced/Transfected and sorted hGICs harbouring either Lentivirus-MGT#1 or PiggyBac-MGT#1/4 were seeded as single cells into 6-well plates in RHB-A medium supplemented with 10ng/ml TNFa (R&D Systems, 210-TA-020) or without TNFa as control ...
-
bioRxiv - Cancer Biology 2023Quote: Ascites collected from RD and IF mice (n=4/ group) were pooled and diluted 1:3 and applied in the adipokine array (ARY-013, R&D systems, Minneapolis, MN, USA). The proteome profiler adipokine array detects 38 adipokines (Table S4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and Fluorogenic Peptide Substrate VII: Z-Leu-Arg-4-methyl-7-coumarylamide (Z-LR-AMC)(Catalog # ES008) were purchased from R&D Systems (Minneapolis, MN, USA). The enzyme reactions were initiated upon addition of ice-cold of hrCTSL (96pM ...
-
bioRxiv - Molecular Biology 2024Quote: ... Plasma concentrations of fatty acid binding protein 4 (FABP4) and leptin were determined using the xMAP technology Luminex assays (R&D Systems, Minneapolis, MN, USA) and the Luminex MAGPIX System (Luminex Corp. ...
-
bioRxiv - Developmental Biology 2023Quote: ... CDX2-88), anti-Nanog rabbit IgG (Cosmo Bio, Tokyo, Japan, cat. no. REC-RCAB0002P-F) and anti-Sox17 goat IgG (R&D Systems, cat no. AF1924) in dilutions of 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were washed and blocked in PBS with 2% donkey serum and 2% bovine serum albumin for an hour and incubated with rabbit anti-IBA1 (WAKO, cat#019-19741, RRID:AB_839504, 1:500) and goat anti-GPNMB (R&D Systems, cat#AF2550, RRID:AB_416615, 3µg/ml) primary antibodies in PBS with 2% donkey serum overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...