Labshake search
Citations for R&D Systems :
2401 - 2450 of 3295 citations for Anti Claudin 3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... and anti-PROX1 (Cat#: AF2727, R&D Systems, 1:200).
-
bioRxiv - Immunology 2023Quote: ... or anti-TNF (1:200, R&D Systems, #AF410-NA) antibodies diluted in PBS overnight at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... 20μg/ml human anti-IFNGR1 (clone GIR208) (R&D System) or human IgG1 (clone MOPC-21 ...
-
bioRxiv - Immunology 2023Quote: ... anti-mouse Csf2ra-Alexa 700 (clone 698423, R&D systems), or anti-mouse CD11b-BV785 (clone M1/70 ...
-
bioRxiv - Cell Biology 2023Quote: ... rat anti-Mertk-AlexaFluor700 (R&D Systems, FAB5912N, 1:200), and rat anti-Axl-AlexaFluor700 (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... or anti-CCR5 (5μg/ml, clone 45531, R&D Systems) blocking antibodies ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-mouse G-CSF ELISA kit (MCS00, R&D Systems), IgE ELISA kit (company?) ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti-Clusterin (1:200, R&D Systems, AF797-SP); rat anti-Cd31 (MEC 13.3 clone ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti mouse-PDGFRα (1:200 AF1062, R&D Systems), rat anti-CD68 (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-Mer tyrosine kinase (MERTK; clone #125518, R&D Systems), anti-purinergic receptor P2Y12 (P2RY12 ...
-
bioRxiv - Neuroscience 2023Quote: ... goat anti SOX1 (1:200, R&D Systems, Biotechne #AF3369) and rabbit anti-gH2A.X (1:400 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or anti-mouse Cd274 (15μg/mL, MAB1561, R&D Systems). The sections were further stained with Alexa Fluor-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... mouse anti-GAPDH (1:1,000, R&D System, Cat. #MAB5718), rabbit anti-vinculin (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... sheep polyclonal anti-PCDH15 (1:200) (AF6729, R&D Systems), donkey anti-rabbit IgG secondary antibody conjugated to Alexa Fluor 594 (1:200) ...
-
bioRxiv - Immunology 2023Quote: ... anti-O1(Cat#MAB1327, RRID:AB_357618, R&D System, 1:100) for mature oligodendrocytes ...
-
bioRxiv - Neuroscience 2023Quote: ... and anti-Rat-HRP (1:20000, R&D systems HAF005).
-
bioRxiv - Neuroscience 2023Quote: ... and rat anti-LGR5 (MAB8240SP, R&D Systems, 1:50). As secondary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... and anti-LAMP1-LD (R&D Systems AF4800 [1:100]). Secondary antibodies and dyes included phallodin Alexafluor 488 (Molecular Probes [1:1000]) ...
-
bioRxiv - Cancer Biology 2023Quote: ... or goat anti-IgG (R&D Systems #AB-1080-C) as a control antibody in the relevant reduced serum media ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD4 (AF-379-NA, R&D Systems, MN, USA), anti-CD8 (NB100-65729 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-Mouse SOST/Sclerostin (R&D Systems, AF1589; 1:500), anti-Ocn (Takara ...
-
Localization of Cadherins in the postnatal cochlear epithelium and their relation to space formationbioRxiv - Cell Biology 2024Quote: ... goat anti-P-cadherin (1:250, AF761, R&D Systems), mouse anti-phosphoTyrosine (1:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-CD13 (R&D Systems, AF2335; dilution 1:100), and mouse monoclonal anti-GABAB (Abcam ...
-
bioRxiv - Cancer Biology 2024Quote: ... mouse anti-MMP1 Mab 901 (R&D Systems 1:750); rabbit anti-actin (Sigma 1:1000) ...
-
bioRxiv - Molecular Biology 2024Quote: ... anti-PDGFRA (R&D Systems, Cat# AF1062, RRID:AB_2236897; 1/80), anti-Laminin α2 (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-NRP1 (1:500, goat polyclonal, AF566 R&D systems); anti-TLE4 (1:500 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Goat anti-PDGFRA (1:500, AF1062, R&D Systems, RRID:AB_2236897), rabbit anti-phospho-Smad1/5 (1:800 ...
-
bioRxiv - Neuroscience 2024Quote: ... sheep anti-EOMES/TBR2 (1:250, AF6166, R&D Systems); rabbit anti-CHD3 (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... and anti-Gr1 (MAB1037-100, rat IgG; R&D Systems). After rinsing ...
-
bioRxiv - Neuroscience 2024Quote: ... anti-PDGFRα (1:1000, Cat. No. AF1062, R&D Systems); polyclonal chicken ...
-
bioRxiv - Bioengineering 2024Quote: ... goat anti-VIM 1:200 (R&D Systems Cat#AF2105), rabbit anti-c-KIT 1:500 (Abcam Cat#ab32363 ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-PTPσ (1:200; R&D Systems, Cat# AF3430), rabbit anti-VGAT (1:300 ...
-
bioRxiv - Developmental Biology 2023Quote: ... CDX2-88), anti-Nanog rabbit IgG (Cosmo Bio, Tokyo, Japan, cat. no. REC-RCAB0002P-F) and anti-Sox17 goat IgG (R&D Systems, cat no. AF1924) in dilutions of 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were washed and blocked in PBS with 2% donkey serum and 2% bovine serum albumin for an hour and incubated with rabbit anti-IBA1 (WAKO, cat#019-19741, RRID:AB_839504, 1:500) and goat anti-GPNMB (R&D Systems, cat#AF2550, RRID:AB_416615, 3µg/ml) primary antibodies in PBS with 2% donkey serum overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: ... and incubated overnight with primary antibodies PDGFRa (1:1000, AF-307-NA, R&D Systems, USA), Collagen 1 (Cat nb ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...