Labshake search
Citations for R&D Systems :
2151 - 2200 of 3035 citations for Anti USP30 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... CDX2-88), anti-Nanog rabbit IgG (Cosmo Bio, Tokyo, Japan, cat. no. REC-RCAB0002P-F) and anti-Sox17 goat IgG (R&D Systems, cat no. AF1924) in dilutions of 1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were washed and blocked in PBS with 2% donkey serum and 2% bovine serum albumin for an hour and incubated with rabbit anti-IBA1 (WAKO, cat#019-19741, RRID:AB_839504, 1:500) and goat anti-GPNMB (R&D Systems, cat#AF2550, RRID:AB_416615, 3µg/ml) primary antibodies in PBS with 2% donkey serum overnight at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2019Quote: ... TIM-3-Alexa Fluor 488 (344823) and TIGIT-APC (741182) antibodies (all from R&D Systems); CD4-APC-H7 (L200) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: ... and incubated overnight with primary antibodies PDGFRa (1:1000, AF-307-NA, R&D Systems, USA), Collagen 1 (Cat nb ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...
-
bioRxiv - Physiology 2019Quote: ... Measurements were undertaken with antibodies & standards from R&D Systems (R&D Systems Europe, Abingdon UK) using a microtiter plate-based two-site electrochemiluminescence immunoassay using the MesoScale Discovery assay platform (MSD ...
-
bioRxiv - Cell Biology 2019Quote: ... Following antibodies were used in this study to recognize Havcr1 (R&D Systems AF1817, 1:500), LTL (Vector Laboratories FL-1321 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A working concentration of 1 μg/ml human ACE2 biotinylated antibody (R&D Systems, Minneapolis, MN) was prepared ...
-
bioRxiv - Developmental Biology 2022Quote: The following primary antibodies were used: human/mouse active Caspase3 (AF835, R&D Systems, 1:200), mouse integrin alpha9 (AF3827 ...
-
bioRxiv - Physiology 2022Quote: Cryosections were stained with primary antibodies to detect CD64 (R&D Systems, Minneapolis, MN, USA #AF2074), and subsequently stained with secondary antibodies conjugated to either Alexa fluor 568 (donkey anti-goat ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were stained using a primary antibody raised against TNR (1/50, AF3865, R&D systems) and secondary antibody conjugated to Rhodamine Red-X raised against goat IgG (1/100 ...
-
bioRxiv - Physiology 2023Quote: ... Sections were then stained overnight at 4°C using primary antibody for SOX9 (R&D Systems) or phosphor-EGFR (phosphoTyr-1173 ...
-
bioRxiv - Immunology 2022Quote: ... The appropriate HRP-conjugated secondary antibodies were used at 1:5000 (1:5000; R&D Systems). For a detailed list of reagents ...
-
bioRxiv - Immunology 2024Quote: ... Human/Mouse ROR gamma t/RORC2/NR1F3 PE-conjugated Antibody (1:10, IC6006P, R&D Systems), and Human/Mouse/Rat FoxP3 PE-conjugated Antibody (1:10 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Bioengineering 2023Quote: ... collected hydrogels from the device were stained with Human/Mouse E-Cadherin Antibody (R&D Systems) at a final concentration of 5 µg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and incubated for 1 h with an antibody raised against decorin69 or VEGFR3 (R&D systems). HRP-conjugated secondary antibody was incubated for 1 h and the immune complexes were revealed using SIGMA-FAST TM O-phenylenediamine dihydrochloride (P9187) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human VEGFR3/Flt-4 antibody (1:500, AF743) was obtained from R&D systems (Minneapolis, MN). Horse Radish Peroxidase (HRP ...
-
bioRxiv - Genomics 2023Quote: ... membranes were probed overnight at 4°C with antibodies that recognize ERAP2 (AF3830, R&D Systems) or α-tubulin (T9026 ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies were added overnight at 1:100 for CD31 (AF3628, R&D Systems, Minneapolis, USA), 1:500 dilution for Iba1 (ab5076 ...
-
bioRxiv - Cancer Biology 2023Quote: ... was used and for p-AXL measurements a pan-tyrosine biotinylated antibody (R&D systems BAM1676) was used ...
-
bioRxiv - Immunology 2024Quote: ... in conjunction with neutralizing antibodies against mouse IFNγ and IL-4 (also from R&D Systems). Culturing was performed in IMDM medium (Gibco ...
-
bioRxiv - Genetics 2024Quote: ... The following antibodies were used in this study: SOX21 (AF3538, R&D Systems, Minneapolis, MN, USA) and beta-Actin (ab8227 ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-goat IgG HRP (HAF109, R&D Systems MI, USA) were used as secondary antibodies ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-p21Waf1/Cip1 (1: 1000, MAB1047, R&D Systems, Minneapolis, USA), anti-phosphorylated p65 (1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-Foxp1(1:100 R&D systems Cat# AF4534, RRID:AB_2107102); rabbit anti-Hoxc8 (1:5000 Sigma-Aldrich Cat# HPA028911 ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat polyclonal anti-SOX2 (1:20; R&D Systems; RRID: AB_355110), rabbit polyclonal anti-OCT4 (1:100 ...
-
bioRxiv - Immunology 2020Quote: ... Biotin goat anti-mouse polyclonal Ephrin-B1 (BAF473) (R&D Systems); FITC anti-BrDU (11-5071-42 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and anti-VEGF164 (R&D Systems, AF-493-NA, 1:100) in 1:1 BB/PBS) ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-Nkx2-5 (25 μg/ml, R&D Systems, #259416), rabbit anti-MYL7 (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit anti-Active Caspase-3 (R&D Systems; AF835; 1:250); mouse anti-Mucin 5AC (Abcam ...
-
bioRxiv - Neuroscience 2019Quote: ... goat anti-SOX2 (1/500; R&D Systems, Cat. No. AF2018); rabbit anti-PAX6 (1/500 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-EphA4 N-terminus (R&D Systems, UK; 1:500), goat anti-EphB2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-DKK1 (R&D systems #AF1096 and Santa Cruz #sc-374574), anti-p-JNK (Cell Signaling #4668) ...
-
bioRxiv - Immunology 2019Quote: ... and allophycocyanin rat anti-mouse CCR6 (clone 140706, R&D Systems).