Labshake search
Citations for R&D Systems :
2101 - 2150 of 4570 citations for Rat Anti Muellerian hormone type 2 receptor AMHR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... in defined media supplemented with 2% B27 and 20ng/ml EGF and bFGF (R&D System). Neurospheres were passaged once and conditioned medium was recovered before the second passage ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant human SUMO-1 and SUMO-2 were purchased from R&D systems (Cat. # K-700). Recombinant human SUMO activating enzyme E1 (SAE1/UBA2 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant human TGF-β1 and mouse or human IL-2 were purchased from R&D system or Biolegend ...
-
bioRxiv - Immunology 2021Quote: ... Th0 cell cultures were provided IL-2 (15 U/mL; R&D Systems 202-IL-500), while Th17 cell cultures were supplemented with IL-6 (20 ng/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... and human fibroblast growth factor 2 (hFGF2) (20 ng/mL, R&D systems 233-FB-025) freshly added into the media ...
-
bioRxiv - Immunology 2023Quote: ... CTL medium containing 100 IU/ml human IL-2 (R&D Systems, 202-IL-010/CF) was added to the plates and the expansion of T cells continued ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 ng/ml glial cell-derived neurotrophic factor (GDNF, R&D Systems, Minneapolis, MN, USA). The experiments were conducted on flasks or multi-well plates (Nunc ...
-
bioRxiv - Systems Biology 2020Quote: ... an APC-anti-ICOSL (R&D Systems) and Alexa-Fluor-700-anti-HLA-DR (Biolegend ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... goat anti-NKp46 (R&D Systems, AF2225), or rat anti-Ly6G (ab2557 NMP-R14 ...
-
bioRxiv - Developmental Biology 2021Quote: ... anti-Oct3/4 (MAB1759, R&D Systems), anti-Sox2 (S1451 ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Tbx6 (R&D Systems, AF4744), rabbit anti-Laminin 111 which detects all laminins containing a1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human PODPCALYXIN (R&D Systems), mouse anti-human SSEA4 (R&D Systems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human SSEA4 (R&D Systems), or mouse anti-human CD9 (R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse anti-human SOX2 (R&D Systems), goat anti-human NANOG (R&D Systems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-human NANOG (R&D Systems), mouse anti-human PODPCALYXIN (R&D Systems) ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-E-cadherin (R&D Systems, AF648), and anti-Snail (NEB ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-DTR (R&D Systems AF259), rat anti-CD68 (1:200 ...
-
bioRxiv - Genomics 2020Quote: ... PE-conjugated anti-KDR (R&D Systems), PECy7-conjugated antiCD31 (BioLegend) ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-SOX1 (AF3369; R&D Systems), rabbit anti-Ki67 (90584 ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-18 (AF2548, R&D systems).
-
bioRxiv - Immunology 2021Quote: ... anti-IL-1β (AF201NA, R&D systems), anti-IL-18 (AF2548 ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Netrin1 (AF1109, R&D Systems), mouse anti-Neurofilament (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathB (R&D Systems, AF965), goat anti-CathD (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-IL6 (MP5-20F3, R&D Systems) and anti-IL1β (AF-401-NA ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-Trk-C (R&D Systems), goat anti-Plexin-A1 (R&D Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse anti-Tenascin-R (R&D Systems), sheep anti-Contactin 1 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... sheep anti-Contactin 1 (R&D Systems), goat anti-CD200 (R&D Systems) ...
-
bioRxiv - Biochemistry 2020Quote: Anti PSMB7 (R&D Systems, Cat. #MAB7590)
-
bioRxiv - Cell Biology 2021Quote: ... Anti-ERK1/ERK2 (#AF1576,R&D systems), 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hDDP4 antibody (R&D Systems) (both antibodies were prepared in OptiMEM medium to the given concentrations) ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hACE2 (R&D systems, AF933), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-SorCS3 (1:500; R&D Systems), anti-PSD-95 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
-
bioRxiv - Immunology 2021Quote: ... anti-vimentin (R&D Systems, # MAB21052-SP), anti-ICP8 (Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
-
bioRxiv - Immunology 2022Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
-
bioRxiv - Immunology 2022Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...