Labshake search

2101 - 2150 of 4004 citations for Mouse anti Coxsackievirus B3 Antibody PV25 since 2019

• PD-L1 Restrains the PD-1^hiNrp1^loTGFβ⁺ Treg to block IL6⁺ Neutrophil tumor infiltration to Suppress Inflammation-driven Colorectal Cancer

  Dakota B. Poschel, et al., bioRxiv - Immunology 2023

  Quote: ... Treg were differentiated from the purified CD4+ cells using CellXVivo Mouse Treg differentiation kit (R&D System). Briefly ...
• Inhibition of the Eukaryotic Initiation Factor-2-α Kinase PERK Decreases Risk of Autoimmune Diabetes in Mice

  Charanya Muralidharan, et al., bioRxiv - Cell Biology 2024

  Quote: ... the proinflammatory cytokine cocktail contained 25 ng/mL mouse IL-1β (R&D Systems; 401-ML-010), 50 ng/mL mouse TNF-α (R&D Systems ...
• Sex-specific resilience of neocortex to food restriction

  Zahid Padamsey, et al., bioRxiv - Neuroscience 2024

  Quote: Serum leptin levels were analyzed using ELISA kits (Mouse Leptin Quantikine Elisa Kit, R&D Systems, USA) according to manufacturer’s instruction ...
• Epstein-Barr virus induced 3 attributes to TLR7-mediated splenomegaly and bicytopenia

  Masanori Iseki, et al., bioRxiv - Immunology 2024

  Quote: ... and then stimulated with recombinant mouse IL-27 (100 ng/ml, R&D Systems, Minneapolis, MN, USA) for 6 hours ...
• ICELLNET: a transcriptome-based framework to dissect intercellular communication

  Floriane Noël, et al., bioRxiv - Systems Biology 2020

  Quote: ... an APC-anti-ICOSL (R&D Systems) and Alexa-Fluor-700-anti-HLA-DR (Biolegend ...
• Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritis

  Daniel J. Rawle, et al., bioRxiv - Immunology 2021

  Quote: ... goat anti-NKp46 (R&D Systems, AF2225), or rat anti-Ly6G (ab2557 NMP-R14 ...
• Heterozygous loss of ZBTB38 leads to early embryonic lethality in mice via suppressing Nanog and Sox2

  Miki Nishio, et al., bioRxiv - Developmental Biology 2021

  Quote: ... anti-Oct3/4 (MAB1759, R&D Systems), anti-Sox2 (S1451 ...
• A TgfβRI/Snai1-dependent developmental module at the core of vertebrate axial elongation

  André Dias, et al., bioRxiv - Developmental Biology 2020

  Quote: ... goat anti-Tbx6 (R&D Systems, AF4744), rabbit anti-Laminin 111 which detects all laminins containing a1 ...
• Derivation of Isogenic Mesodermal and Ectomesodermal Chondrocytes from Human Induced Pluripotent Stem Cells for Articular Cartilage Regeneration

  Ming-Song Lee, et al., bioRxiv - Developmental Biology 2020

  Quote: ... goat anti-human NANOG (R&D Systems), mouse anti-human PODPCALYXIN (R&D Systems) ...
• Genome-wide in vivo screen of circulating tumor cells identifies SLIT2 as a regulator of metastasis

  Fan Xia, et al., bioRxiv - Cancer Biology 2022

  Quote: ... anti-E-cadherin (R&D Systems, AF648), and anti-Snail (NEB ...
• Microglia drive pockets of neuroinflammation in middle age

  Eric N. Moca, et al., bioRxiv - Neuroscience 2021

  Quote: ... goat anti-DTR (R&D Systems AF259), rat anti-CD68 (1:200 ...
• Tropomyosin 1 genetically constrains in vitro hematopoiesis

  CS Thom, et al., bioRxiv - Genomics 2020

  Quote: ... PE-conjugated anti-KDR (R&D Systems), PECy7-conjugated antiCD31 (BioLegend) ...
• Geminin is required for Hox gene regulation to pattern the developing limb

  Emily M.A. Lewis, et al., bioRxiv - Developmental Biology 2020

  Quote: ... goat anti-SOX1 (AF3369; R&D Systems), rabbit anti-Ki67 (90584 ...
• Oxidized thioredoxin-1 restrains the NLRP1 inflammasome

  Daniel P. Ball, et al., bioRxiv - Immunology 2021

  Quote: ... anti-IL-18 (AF2548, R&D systems).
• Oxidized thioredoxin-1 restrains the NLRP1 inflammasome

  Daniel P. Ball, et al., bioRxiv - Immunology 2021

  Quote: ... anti-IL-1β (AF201NA, R&D systems), anti-IL-18 (AF2548 ...
• The DCC receptor regulates astroglial development essential for telencephalic morphogenesis and corpus callosum formation

  Laura Morcom, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-Netrin1 (AF1109, R&D Systems), mouse anti-Neurofilament (1:500 ...
• A multifaceted role of progranulin in regulating amyloid-beta dynamics and responses

  Huan Du, et al., bioRxiv - Neuroscience 2021

  Quote: ... goat anti-CathB (R&D Systems, AF965), goat anti-CathD (R&D Systems ...
• A multifaceted role of progranulin in regulating amyloid-beta dynamics and responses

  Huan Du, et al., bioRxiv - Neuroscience 2021

  Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
• Hyperphosphatemia increases inflammation to exacerbate anemia and skeletal muscle wasting independently of FGF23-FGFR4 signaling

  Brian Czaya, et al., bioRxiv - Cell Biology 2021

  Quote: ... Anti-IL6 (MP5-20F3, R&D Systems) and anti-IL1β (AF-401-NA ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-Kit/SCFR (R&D Systems), mouse anti-LSAMP (Developmental Studies Hybridoma Bank) ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... sheep anti-Contactin 1 (R&D Systems), goat anti-CD200 (R&D Systems) ...
• Synapse type-specific proteomic dissection identifies IgSF8 as a hippocampal CA3 microcircuit organizer

  Nuno Apóstolo, et al., bioRxiv - Neuroscience 2020

  Quote: ... goat anti-Kit/SCFR (R&D Systems), goat anti-NEGR1 (R&D Systems) ...
• Proteasome-Bound UCH37 Debranches Ubiquitin Chains to Promote Degradation

  Kirandeep K. Deol, et al., bioRxiv - Biochemistry 2020

  Quote: Anti PSMB7 (R&D Systems, Cat. #MAB7590)
• O-GlcNAcylation is essential for rapid Pomc expression and cell proliferation in corticotropic tumor cells

  Logan J Massman, et al., bioRxiv - Cell Biology 2021

  Quote: ... Anti-ERK1/ERK2 (#AF1576,R&D systems), 1:500 ...
• Identification of TMEM106B as proviral host factor for SARS-CoV-2

  Jim Baggen, et al., bioRxiv - Microbiology 2020

  Quote: ... or anti-hACE2 (R&D systems, AF933), respectively ...
• Inhibiting proBDNF to mature BDNF conversion leads to autism-like phenotypes in vivo

  He You, et al., bioRxiv - Neuroscience 2020

  Quote: ... anti-SorCS3 (1:500; R&D Systems), anti-PSD-95 (1:1000 ...
• Evaluation of SARS-CoV-2 Entry, Inflammation and New Therapeutics in Human Lung Tissue Cells

  Judith Grau-Expósito, et al., bioRxiv - Microbiology 2021

  Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
• Nuclear soluble cGAS senses DNA virus infection

  Yakun Wu, et al., bioRxiv - Immunology 2021

  Quote: ... anti-vimentin (R&D Systems, # MAB21052-SP), anti-ICP8 (Abcam ...
• A TgfβRI/Snai1-dependent developmental module at the core of vertebrate axial elongation

  André Dias, et al., bioRxiv - Developmental Biology 2020

  Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
• PHF6 Interacts with LMO2 During Normal Haematopoiesis and in Leukaemia and Regulates Gene Expression and Genome Integrity

  Vesna S. Stanulović, et al., bioRxiv - Cancer Biology 2020

  Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
• PHF6 Interacts with LMO2 During Normal Haematopoiesis and in Leukaemia and Regulates Gene Expression and Genome Integrity

  Vesna S. Stanulović, et al., bioRxiv - Cancer Biology 2020

  Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
• Myomegalin regulates Hedgehog pathway by controlling PDE4D at the centrosome

  Hualing Peng, et al., bioRxiv - Cell Biology 2021

  Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
• Claudin5 protects the peripheral endothelial barrier in an organ and vessel type-specific manner

  M Richards, et al., bioRxiv - Cell Biology 2022

  Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
• TGF-β-R2 is required for HBP induced acute lung injury and vascular leakage for TGF-β/Smad/Rho signaling pathway activation

  Zixuan Liu, et al., bioRxiv - Molecular Biology 2022

  Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
• IKK2/NFkB signaling controls lung resident CD8 T cell memory during influenza infection

  Curtis J. Pritzl, et al., bioRxiv - Immunology 2022

  Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
• IKK2/NFkB signaling controls lung resident CD8 T cell memory during influenza infection

  Curtis J. Pritzl, et al., bioRxiv - Immunology 2022

  Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...
• Sorting single T cells based on secreted cytokines and surface markers using hydrogel nanovials

  Doyeon Koo, et al., bioRxiv - Bioengineering 2022

  Quote: ... and anti-IFN-γ (R&D Systems), anti-TNF-α (R&D Systems) ...
• The Wnt/TCF7L1 transcriptional repressor axis drives primitive endoderm formation by antagonizing naive and formative pluripotency

  Paraskevi Athanasouli, et al., bioRxiv - Developmental Biology 2022

  Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
• Novel roles of small extracellular vesicles in regulating the quiescence and proliferation of neural stem cells

  Jingtian Zhang, et al., bioRxiv - Developmental Biology 2021

  Quote: ... rat anti-MFG-E8 (R&D Systems), mouse anti-CD63 (Novus Biologicals ...
• SCARF1-induced efferocytosis plays an immunomodulatory role in humans, and autoantibodies targeting SCARF1 are produced in patients with systemic lupus erythematosus

  April M. Jorge, et al., bioRxiv - Immunology 2021

  Quote: ... Anti-SCARF1 (R&D Systems, Minneapolis MN) was used as a positive control ...
• A noble TGFβ biogenesis inhibitor exhibits both potent anti-fibrotic and anti-inflammatory capabilities

  Han-Soo Kim, et al., bioRxiv - Pharmacology and Toxicology 2021

  Quote: ... 1:500 anti-MyD88 (R&D systems), 1:500 anti-TLR4 (R&D systems ...
• A noble TGFβ biogenesis inhibitor exhibits both potent anti-fibrotic and anti-inflammatory capabilities

  Han-Soo Kim, et al., bioRxiv - Pharmacology and Toxicology 2021

  Quote: ... 1:500 anti-TLR4 (R&D systems) or 1:500 anti- MD-2 (Abcam ...
• A noble TGFβ biogenesis inhibitor exhibits both potent anti-fibrotic and anti-inflammatory capabilities

  Han-Soo Kim, et al., bioRxiv - Pharmacology and Toxicology 2021

  Quote: ... anti-Myd88 (1:500, R&D systems) for overnight at 4°C ...
• A multifaceted role of progranulin in regulating amyloid-beta dynamics and responses

  Huan Du, et al., bioRxiv - Neuroscience 2021

  Quote: ... goat anti-CathL (R&D Systems, AF1515), sheep anti-TREM2 (R&D Systems ...