Labshake search
Citations for R&D Systems :
2001 - 2050 of 3799 citations for Mouse Anti Campylobacter Jejuni Antibody CA30 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... anti-IL-1β (AF201NA, R&D systems), anti-IL-18 (AF2548 ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Netrin1 (AF1109, R&D Systems), mouse anti-Neurofilament (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathB (R&D Systems, AF965), goat anti-CathD (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathD (R&D Systems, AF1029), goat anti-CathL (R&D Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... Anti-IL6 (MP5-20F3, R&D Systems) and anti-IL1β (AF-401-NA ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), mouse anti-LSAMP (Developmental Studies Hybridoma Bank) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-PTPRS (R&D Systems). Fluorophore-conjugated secondary antibodies were from Jackson ImmunoResearch or Invitrogen.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems) and goat anti-PTPRS (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and goat anti-IgSF8 (R&D Systems). HRP-conjugated secondary antibodies were from Thermo-Fisher.
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Plexin-A1 (R&D Systems), rabbit anti-PTPRD (Novus) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-NEGR1/Kilon (R&D Systems), mouse anti-Neuronal pentraxin 1 (BD Biosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... sheep anti-Contactin 1 (R&D Systems), goat anti-CD200 (R&D Systems) ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-Kit/SCFR (R&D Systems), goat anti-NEGR1 (R&D Systems) ...
-
bioRxiv - Biochemistry 2020Quote: Anti PSMB7 (R&D Systems, Cat. #MAB7590)
-
bioRxiv - Cell Biology 2021Quote: ... Anti-ERK1/ERK2 (#AF1576,R&D systems), 1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... or anti-hACE2 (R&D systems, AF933), respectively ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-SorCS3 (1:500; R&D Systems), anti-PSD-95 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... primary goat anti-ACE2 (R&D systems), anti-CD14 (APC-H7 ...
-
bioRxiv - Immunology 2021Quote: ... anti-vimentin (R&D Systems, # MAB21052-SP), anti-ICP8 (Abcam ...
-
bioRxiv - Developmental Biology 2020Quote: ... goat anti-Cdh1 (R&D Systems, AF648), rabbit anti-Cdh2 (Abcam ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
-
bioRxiv - Immunology 2022Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
-
bioRxiv - Immunology 2022Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...
-
bioRxiv - Bioengineering 2022Quote: ... and anti-IFN-γ (R&D Systems), anti-TNF-α (R&D Systems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-MFG-E8 (R&D Systems), mouse anti-CD63 (Novus Biologicals ...
-
bioRxiv - Immunology 2021Quote: ... Anti-SCARF1 (R&D Systems, Minneapolis MN) was used as a positive control ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1:500 anti-MyD88 (R&D systems), 1:500 anti-TLR4 (R&D systems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1:500 anti-TLR4 (R&D systems) or 1:500 anti- MD-2 (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-Myd88 (1:500, R&D systems) for overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathL (R&D Systems, AF1515), sheep anti-TREM2 (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... sheep anti-TREM2 (R&D Systems, AF1729), rabbit anti IBA-1 (Wako ...
-
bioRxiv - Systems Biology 2022Quote: ... goat anti-EGFR (AF231, R&D Systems), rabbit anti-phospho-ERK-1/2 Thr/Tyr 202/204 (9101 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-CAR (cat# AF336, R&D systems) was used at 1/10th with Donkey anti-goat Alexa Fluor 488 secondary antibody (cat# A11055 ...
-
bioRxiv - Cancer Biology 2019Quote: ... goat anti-CD31 (R&D System; AF3628) and anti-goat AlexaFluor594 (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147); mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147), mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-TM_#501733 (MAB3947; R&D Systems), anti-His_#AD1.1.10 (MAB050 ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-His_#AD1.1.10 (MAB050; R&D Systems), and goat anti-mouse IgG Alexa-594 (R37121 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Goat anti-MITF (R&D systems, AF5769) 1:100.
-
bioRxiv - Cell Biology 2019Quote: ... anti-VEGFR2 (AF644 89106 R&D System).
-
bioRxiv - Biochemistry 2019Quote: ... APC-conjugated anti-proTGFβ1 (R&D Systems), mouse IgG (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... goat anti-CD31 (R&D Systems; AF3628), rabbit anti-activated-caspase-3 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-Gdf3 (R&D Systems, MAB953), mouse anti-β-Actin (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-rat IgG (#HAF005, R&D Systems) and anti-rabbit IgG (#7074 ...