Labshake search
Citations for R&D Systems :
2001 - 2050 of 3974 citations for Heat Shock Factor Protein 1 HSF1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1:10,000 (R&D Systems MAB9205); anti-GFP ...
-
bioRxiv - Cell Biology 2020Quote: ... using recombinant carrier free ACE2 (# 933-ZN-010) and Skp1/Skp2 (#E3-521-025) proteins bought from R&D Systems (Minneapolis, MN, USA) or Flag-ACE2 and Flag-Skp1/Skp2 purified from 293T cells ...
-
bioRxiv - Neuroscience 2021Quote: ... Nrp1-Fc fusion protein containing the extracellular domain of rat Nrp1 (amino acid 22-854 minus 811-828; R&D Systems, 566-NNS) or the control human Fc dimer (R&D Systems ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50μl of mitochondria (1μg/μl protein) were treated with Caspase-8-cleaved tBid from 5-500nM (882-B8-050, R&D Systems, Minneapolis, MN), Bim-BH3 from 10-10,000nM (Ac-DMRPEIWIAQELRRIGDEFNAYYARR-amide ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2014) has a 42% sequence identity and 58% sequence similarity with the recombinant zebrafish BMP4 protein (R&D Systems, cat. 1128-BM-010) used ...
-
bioRxiv - Cancer Biology 2020Quote: ... Presence of 105 proteins in supernatants was evaluated using human cytokine and chemokine XL proteome array kit from R&D Systems (Minneapolis, MN).
-
bioRxiv - Neuroscience 2022Quote: ... progranulin concentrations were determined in duplicate using 10–15 μl of lysates per well (typically 8–20 μg of total protein per well) using a sandwich ELISA assay (R&D Systems, DPGRN0). For experiments analyzing secreted progranulin ...
-
bioRxiv - Immunology 2021Quote: The expression of NKG2D ligands in tumor cell lines was assessed using Recombinant Human NKG2D Fc Chimera Protein (R&D systems, Abingdon, UK). 105 tumor cells were incubated either with 0.5 μg of NKG2D Fc recombinant protein or IgG1-Fc during 30 min ...
-
bioRxiv - Microbiology 2021Quote: Sterile tissue culture plates were coated overnight at 4°C with 5 µg/mL recombinant CD62P protein (R&D Systems, #137-PS-050). The following day the wells were washed 3X with PBS before being blocked with 1% BSA in PBS at room temperature (RT ...
-
bioRxiv - Neuroscience 2022Quote: ... A subset of slices were infected with only AAV9.hsyn.GFP and at DIV6 were treated with human Sema4D-Fc ectodomain/human Fc fusion protein (Sema4D-Fc; R&D Systems, #7470-S4) or Fc control protein (R&D Systems ...
-
bioRxiv - Microbiology 2022Quote: ... The HA remaining after supernatant-driven degradation was detected with HA binding protein following dilutions and instructions in the Hyaluronan DuoSet ELISA kit by R&D Systems (DY3614). As was the case for fibronectin and laminin ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were left for 48h to allow expression of LepRb-HA protein before treatment with recombinant murine leptin (R&D System #498-OB) at 0-10 ng/L for 30 minutes before cell lysis and western blotting for phosphoSTAT3 (Y705) ...
-
bioRxiv - Bioengineering 2023Quote: ... The relative expression levels of apoptosis related proteins of post I/RI iCMs (n=3) were analyzed using the Proteome Profiler Human Apoptosis Array (R&D Systems, #ARY009), according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2023Quote: ... ciCMVEC were placed in serum-free media 1h before treatment with 10 ng/ml of Recombinant Human TNF-α Protein (210-TA-005; R&D systems) or vehicle (PBS ...
-
bioRxiv - Cell Biology 2024Quote: Secreted proteins were measured in cell culture supernatants from treated iBMDMs using ELISAs for IL-1β and CCL5 (Quantikine®, R&D systems).
-
bioRxiv - Bioengineering 2024Quote: ... IDUA activity was assessed using 4-methylumberlliferyl-alpha-L-iduronide (Glycosynth, Cheshire, England) and recombinant human alpha-L-iduronidase protein (R&D systems, Minneapolis) following manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2023Quote: ... Subsequently cell clusters were differentiated into β-like cells by exposure to the appropriate media as previously published.29 All recombinant proteins were purchased from R&D System unless otherwise stated (see Supplementary Table 3).
-
bioRxiv - Immunology 2024Quote: ... Protein lysates were subjected to enzyme-linked immunosorbent assay (ELISA) using mouse DuoSet® ELISA commercial kits (R&D Systems, Minneapolis, MN, USA), following manufacturer instructions.
-
bioRxiv - Systems Biology 2023Quote: Where indicated the cells were stimulated with the final concentration of 10 ng/ml of recombinant human TNF-α protein (R&D Systems) or 100 ng/ml of recombinant human interleukin 1 beta (IL-1β ...
-
bioRxiv - Biochemistry 2023Quote: ... and 250 μg of protein from each condition was incubated with a membrane array from the Proteome Profiler Human XL Cytokine Array Kit (R&D Systems, ARY022B). Membranes were processed according to the manufacturer’s instructions and imaged using an ImageQuant LAS 4000 (GE Healthcare) ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...
-
bioRxiv - Bioengineering 2021Quote: ... the slides were incubated in 5 μg/mL solution of anti-SOX2 antibodies (R&D Systems) or 5 μg/mL solution of anti-Sox17 (SantaCruz ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies for immunoprecipitation and Western blotting included anti-V5 and anti-His (R&D systems), Mouse anti-VAMP2 (SySy Synaptic Systems ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then stained with phycoerythrin (PE)-conjugated anti-sheep secondary antibody IgG (F0126, R&D systems). Cell sorting was conducted on a BD FACSAria IIu cell sorter (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2019Quote: ... TIM-3-Alexa Fluor 488 (344823) and TIGIT-APC (741182) antibodies (all from R&D Systems); CD4-APC-H7 (L200) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: The following primary antibodies were used in Western blotting experiments: anti-MTf (R&D systems, MAB8175), CD63 (Abcam ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated in different concentrations of goat anti-mouse Nrp1 antibody (R&D Systems, AF566) or 1 μg/mL of goat anti-mouse PDGFRα antibody (R&D Systems ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...
-
bioRxiv - Immunology 2020Quote: The following primary antibodies were used for flow cytometry: anti-MICA (clone 159227; R&D Systems) and anti-MICB (clone 236511 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...
-
bioRxiv - Physiology 2019Quote: ... Measurements were undertaken with antibodies & standards from R&D Systems (R&D Systems Europe, Abingdon UK) using a microtiter plate-based two-site electrochemiluminescence immunoassay using the MesoScale Discovery assay platform (MSD ...
-
bioRxiv - Cancer Biology 2020Quote: ... For westerns we used a monoclonal anti-human PRL antibody (R&D System, Minneapolis, MN, USA), rabbit anti-STAT5 (phospho Y694 ...
-
bioRxiv - Microbiology 2019Quote: ... CC3 staining was performed using rabbit polyclonal anti-active Caspase-3 antibody (AF835, R&D systems) and peroxidase-labelled anti-rabbit EnVision™ secondary antibody (Dako ...
-
bioRxiv - Microbiology 2020Quote: ... we then stained with 2 μg of anti-ACE2 goat IgG antibody (R&D Systems, AF933) per million cells followed by a FITC-conjugated secondary antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2020Quote: ... inhibition experiment was performed in the presence of anti-DC/L-SIGN antibody (R&D Systems). Cells were then washed as described above ...
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The following neutralizing antibodies were used: anti-CXCL12 (R&D systems, clone 79014, 100 ug/ml) and anti-CXCL2 (Thermo Fisher ...