Labshake search
Citations for R&D Systems :
1351 - 1400 of 2051 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were incubated overnight with goat anti-human IGF-II antibody (R&D Systems; AF292). Alexa Fluor® 488-AffiniPure antibody (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... by using a cocktail of antibodies: goat anti-podocalyxin (1:1500, AF1556, R&D Systems), goat anti-CD31 (1:300 ...
-
bioRxiv - Cancer Biology 2023Quote: Neutralizing BMP6 antibodies (MAB507 for human, MAB6325 for mouse) were purchased from R&D system. LDN214117 (S7627 ...
-
bioRxiv - Physiology 2023Quote: ... primary antibodies of 1:200 Goat anti-CD31 (R&D systems, U.K, goat anti-PECAM1) and 1:500 anti-desmin (Abcam ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following antibodies were used: Anti-mouse IFNγ (R&D systems, Cat. No. IC485F-025), anti-mouse IL12 (BioLegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated with anti-MHC antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400) ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... or CD31/PECAM-1 Alexa Fluor 488-conjugated Antibody (1:200; R&D system #FAB3628G). After primary antibody incubation ...
-
bioRxiv - Immunology 2023Quote: ... and were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Immunology 2023Quote: ... cells were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Biochemistry 2022Quote: Antibodies used for flow cytometry included: mouse anti-human FAP-APC (R&D Systems, FAB3715A), sheep anti-human FAP (R&D Systems ...
-
bioRxiv - Developmental Biology 2023Quote: The following antibodies were used: goat anti-PROX1 (Cat#: AF2727, R&D Systems, 1:100), rat anti-Endomucin (Cat# ...
-
bioRxiv - Immunology 2023Quote: ... antibody was purchased from Invitrogen and monoclonal anti-mouse Axl antibody (clone 175128) from R&D Systems (Minneapolis, MN, USA). Polyclonal anti-mouse LXRα antibody (#ab3585 ...
-
bioRxiv - Neuroscience 2023Quote: The primary antibodies used for immunostaining were goat anti-Pdgfrα (1:250, R&D Systems), rabbit anti-Pdgfrα (1:250 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or monoclonal antibody to human POSTN (R&D Systems, Cat # AF3548, at 10 µg/mL), or anti-human IgG (Abcam ...
-
bioRxiv - Physiology 2023Quote: ... Further incubations with anti-VEGFR2 N-terminal antibody (rabbit, 1:100, R&D Systems, USA) and goat anti-rabbit IgG H+L Alexa Fluor 488 (1:1000 ...
-
bioRxiv - Cancer Biology 2023Quote: A membrane-based antibody array (Proteome Profiler Human Cytokine Array Kit, R&D Systems, ARY005B) was used to profile 36 soluble proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... the nuclei were then stained with anti-SOX10 antibody (R&D Systems, AF2864, 1:250) + anti-Goat AF488 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used: mouse anti-IGFBP3 (R&D systems, MAB305-100, 1:200), rabbit anti-PAI1/SERPINE1 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10 μL intramuscular injection of Spp1 neutralizing antibody (4 μg, AF808, R&D Systems) was administered into the tibialis anterior (TA ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunofluorescence staining on these sections involved primary antibodies against anti-CD45 (AF114, R&D Systems), Biotin-conjugated anti-podoplanin (127403 ...
-
bioRxiv - Microbiology 2023Quote: ... and then anti-goat horseradish peroxidase-conjugated antibody (Catalog #HAF017, R&D Systems, Minneapolis, MN) was added at 1:1000 dilution at room temperature for 1 hour ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibody against advanced glycosylation end-product specific receptor (AGER, R&D Systems, 1:250), pro-surfactant protein C (pro-SFTPC ...
-
bioRxiv - Bioengineering 2024Quote: ... Secondary antibody Donkey Anti-Goat IgG NL637 Affinity Purified PAb (#NL002, R&D Systems Inc) at a concentration of 20 μg/mL was added to the tissue section and incubated for 2 hours at room temperature ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% Triton X-100 before staining with antibodies for KDR (R&D Systems #AF644), CD45 (BD Biosciences #550539) ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell cultures were immunolabelled with O4 antibody diluted 1:200 (R&D Systems, Oakville, ON) for one hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies used were as follows: PKR: anti-PKR (human) monoclonal (71/10, R&D Systems), p-eIF2α ...
-
bioRxiv - Cancer Biology 2019Quote: ... and the supernatant was tested using the Quantikine human IL-6 (sensitivity < 5 pg/mL) ELISA kit (R&D Systems, Inc., Minneapolis, MN) according to manufacturer’s recommended conditions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50μl of mitochondria (1μg/μl protein) were treated with Caspase-8-cleaved tBid from 5-500nM (882-B8-050, R&D Systems, Minneapolis, MN), Bim-BH3 from 10-10,000nM (Ac-DMRPEIWIAQELRRIGDEFNAYYARR-amide ...
-
bioRxiv - Immunology 2021Quote: All cells were grown in a humidified incubator at 37°C and 5% CO2 and cell lines tested mycoplasma negative (MycoProbe® Mycoplasma Detection Kit, R&D systems).
-
bioRxiv - Immunology 2020Quote: ... paraformaldehyde-fixed frozen sections were treated with citrate buffer (pH 7.0, 121°C, 5 min) before immunostaining with sheep anti-mouse Spi-B polyclonal Ab (R&D Systems, Abingdon, UK). CCL20 ...
-
bioRxiv - Genomics 2019Quote: ... as from previous dose-response experiments3–5: recombinant human IL-1β (specific activity 1.8×107 U/mg; 201-LB-005, R&D Systems, Abingdon, UK) at 50 U/ml ...
-
bioRxiv - Cancer Biology 2021Quote: ... The cells were resuspended in 100 µl total volume and stained with 5 µl anti-His-PE (#IC050P, R&D Systems, Minneapolis, MN) or anti-CD19 antibody FMC63-PE (#MAB1794 ...
-
bioRxiv - Cell Biology 2021Quote: ... Media was replaced after 48 hours (Day 2) with RPMI-1640 supplemented with B27 without insulin and 5 µM IWP2 (R&D Systems #3533). Media was again replaced after an additional 48 hours (Day 4 ...
-
bioRxiv - Microbiology 2021Quote: Sterile tissue culture plates were coated overnight at 4°C with 5 µg/mL recombinant CD62P protein (R&D Systems, #137-PS-050). The following day the wells were washed 3X with PBS before being blocked with 1% BSA in PBS at room temperature (RT ...
-
bioRxiv - Immunology 2022Quote: Substrate functionalization was performed by overnight incubation with 5 µg/ml CCL21 and 50 µg/ml ICAM1 (R&D Systems, Minneapolis, MN, USA), in PBS.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were grown in a humidified incubator at 37∘C and 5% CO2 and tested mycoplasma negative (MycoProbe® Mycoplasma Detection Kit, R&D systems). HEK293T cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... supernatant was collected and centrifuged (3000 rpm, 5 min, RT) and Secreted IL6 was measured using the Quantikine® ELISA kit (R&D Systems), following manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 5 × 105 IHMCs were plated in each 96-well and incubated in 75µL complete R10 media with rhMIF (R&D Systems; 1mg/mL) or vehicle (PBS + 0.2% BSA ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVECs were seeded in tissue culture-treated 12-well plates coated with human fibronectin (5 µg/cm2) (R&D Systems, Cat. # 1918-FN). Stimulated and unstimulated groups were formed as described above ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibodies were used in immunostaining: Anti-FOXA2 (R&D systems, #AF2400; 1:100), Anti-OLIG2 (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... We used following primary antibodies and dilutions: anti-(murine)SorCS2 1:1000 (#AF4237, R&D Systems), anti-DARPP-32 1:1000 (#AB40801 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...