Labshake search
Citations for R&D Systems :
1251 - 1300 of 3056 citations for Rabbit Anti Borrelia burgdorferi sensu stricto B31 P39 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cell Biology 2021Quote: ... goat anti-Gli2 (AF3635, R&D SYSTEMS), rabbit anti-pPKA (ab59218 ...
-
bioRxiv - Cell Biology 2022Quote: ... goat anti-CD31 (R&D Systems, AF3628), goat anti-VE-Cadherin (R&D Systems ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-HBP (mAb #246322, R&D systems), anti-HBP (pAb ab167336 ...
-
bioRxiv - Immunology 2022Quote: ... anti-Runx3 (527327) from R&D systems; anti-Eomes (Dan11mag ...
-
bioRxiv - Immunology 2022Quote: ... anti-SMAD7(293739) from R&D Systems; anti-α-tubulin (B-5 ...
-
bioRxiv - Bioengineering 2022Quote: ... and anti-IFN-γ (R&D Systems), anti-TNF-α (R&D Systems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... goat anti-Gata6 (R&D systems, AF1700) (1:200) ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-MFG-E8 (R&D Systems), mouse anti-CD63 (Novus Biologicals ...
-
bioRxiv - Immunology 2021Quote: ... Anti-SCARF1 (R&D Systems, Minneapolis MN) was used as a positive control ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1:500 anti-MyD88 (R&D systems), 1:500 anti-TLR4 (R&D systems ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 1:500 anti-TLR4 (R&D systems) or 1:500 anti- MD-2 (Abcam ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... anti-Myd88 (1:500, R&D systems) for overnight at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-CathL (R&D Systems, AF1515), sheep anti-TREM2 (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... sheep anti-TREM2 (R&D Systems, AF1729), rabbit anti IBA-1 (Wako ...
-
bioRxiv - Systems Biology 2022Quote: ... goat anti-EGFR (AF231, R&D Systems), rabbit anti-phospho-ERK-1/2 Thr/Tyr 202/204 (9101 ...
-
bioRxiv - Immunology 2022Quote: ... Anti-CAR (cat# AF336, R&D systems) was used at 1/10th with Donkey anti-goat Alexa Fluor 488 secondary antibody (cat# A11055 ...
-
bioRxiv - Cancer Biology 2019Quote: ... goat anti-CD31 (R&D System; AF3628) and anti-goat AlexaFluor594 (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147); mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Developmental Biology 2019Quote: ... goat-anti-Robo2 (R&D systems, AF3147), mouse-anti-EphB2 (Santa Cruz ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-TM_#501733 (MAB3947; R&D Systems), anti-His_#AD1.1.10 (MAB050 ...
-
bioRxiv - Molecular Biology 2019Quote: ... anti-His_#AD1.1.10 (MAB050; R&D Systems), and goat anti-mouse IgG Alexa-594 (R37121 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Goat anti-MITF (R&D systems, AF5769) 1:100.
-
bioRxiv - Cell Biology 2019Quote: ... anti-VEGFR2 (AF644 89106 R&D System).
-
bioRxiv - Biochemistry 2019Quote: ... APC-conjugated anti-proTGFβ1 (R&D Systems), mouse IgG (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2019Quote: ... goat anti-CD31 (R&D Systems; AF3628), rabbit anti-activated-caspase-3 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... rat anti-Gdf3 (R&D Systems, MAB953), mouse anti-β-Actin (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... anti-rat IgG (#HAF005, R&D Systems) and anti-rabbit IgG (#7074 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-mouse Arginase I (R&D Systems) was used at recommended dilution for staining of permeabilized cells for 40 mins at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-Reelin (AF3820) from R&D Systems; anti-Cux1 (sc-13024 ...
-
bioRxiv - Developmental Biology 2019Quote: ... anti-Bcl2A1 (R&D Systems, 1/500), anti-Hexokinase II (Cell Signaling ...
-
bioRxiv - Immunology 2020Quote: ... anti-human CXCL13 (53610, R&D Systems) and GZMB (REA226 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-Dppa4 (R&D Systems, AF3730) 1:100 ...
-
bioRxiv - Cell Biology 2021Quote: ... anti P-selectin (R&D Systems, #AF737), anti ITGβ3 (Cell Signaling Technology ...
-
bioRxiv - Developmental Biology 2021Quote: ... rat anti-CER1 (R&D Systems, MAB1986), goat anti-T (1:250 ...
-
bioRxiv - Developmental Biology 2021Quote: ... goat anti-DKK1 (R&D Systems, AF1765), rabbit ranti-Aldh1a2 (Abcam ab96060) ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-GPNMB (R&D Systems, AF2330), mouse anti-GAPDH (Proteintech Group ...
-
bioRxiv - Biochemistry 2021Quote: Anti PSMB7 (R&D Systems, Cat. #MAB7590)
-
bioRxiv - Cancer Biology 2021Quote: ... anti-HGFR (R&D Systems, Cat AF276) and anti-EGFR1 (BDPharmingen ...
-
Splicing variation of BMP2K balances endocytosis, COPII trafficking and autophagy in erythroid cellsbioRxiv - Cell Biology 2020Quote: ... anti-GFP (AF4240) from R&D Systems; anti-SEC16A (A300-648A ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL15(2) (R&D systems, #MAB247) at 5µg/ml ...
-
bioRxiv - Immunology 2021Quote: ... anti-FCRL5-af88 (polyclonal, R&D systems) anti-IgM-PECy7 (RMM-1 ...
-
bioRxiv - Genomics 2021Quote: ... anti-goat-HRP (R&D systems, HAF019), anti-rabbit-HRP (GE healthcare ...
-
bioRxiv - Bioengineering 2021Quote: ... anti-human ACE2 (R&D Systems, #HK0320042), PE-labelled anti-human IgG (Southern Biotech ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-IFNγR1/CD119 (R&D Systems, MAB10261), anti-STAT1 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2022Quote: ... anti-mouse Oncostatin M (R&D systems), anti-mouse IL-6 (BioxCell) ...
-
bioRxiv - Cell Biology 2022Quote: ... anti HNE (R&D system 198960, RRID:AB_664165), anti-Citrate synthase (Abcam ab96600 ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-SOX2 (R&D Systems, Cat# MAB2018), anti-POLR1D (Proteintech ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-ppGalNAc-T3 (sheep, R&D Systems), anti-ppGalNAc-T6 (rabbit ...