Labshake search
Citations for R&D Systems :
1251 - 1300 of 3481 citations for Pituitary Tumor Transforming 1 PTTG1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
CAP1 and cofilin1 cooperate in neuronal actin dynamics, growth cone function and neuron connectivitybioRxiv - Neuroscience 2020Quote: ... 50 nM Semaphorin 4D (Thomas Worzfeld lab) or 1 µg/µl Slit-1 (R&D System) for 60 min ...
-
bioRxiv - Cell Biology 2022Quote: ... DPP4 (IF/FACS 1:100, #HBB3/775/42, DSHB; EM 1:10, #AF1180, R&D Systems), E-Cadherin (IF 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... specifically: goat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1)/CD31 (R&D Systems), mouse anti-mouse α-smooth muscle actin (αSMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse mAb to βIII-tubulin conjugated to Alexa488 (Clone Tuj-1, R&D Systems, 1/500), mouse mAb to HNK-1 described previously ((Tucker et al. ...
-
bioRxiv - Physiology 2024Quote: ... IGF-1 in serum was measured using Mouse/Rat IGF-1 Quantikine ELISA (R&D Systems) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... and MCP-1 (Mouse CCL2/JE/MCP-1 Quantikine ELISA Kit, R&D Systems, catalog # MJE00B) in the brain ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells in PBS were mixed 1:1 with Cultrex TM (R&D systems, Minneapolis, MN, USA) at a final concentration of 1 x 106 in 100 μl prior to injection ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit IgG (#ab105C; 1:1000) and goat IgG (#ab108C; 1:200) were from R&D Systems. Secondary conjugated polyclonal donkey anti-rabbit IgG Alexa 594 (#A-21206 ...
-
bioRxiv - Cell Biology 2020Quote: ... SOX17 (R&D Systems, 1:50), TH (Millipore ...
-
bioRxiv - Cell Biology 2020Quote: ... NANOG (R&D Systems, 1:200), SMA (DakoCytomation ...
-
bioRxiv - Developmental Biology 2021Quote: ... SOX17 (1:50; R&D Systems), E-CAD (1.200 ...
-
bioRxiv - Cell Biology 2022Quote: ... Vasa (1:500, R&D systems), γTub (1:500 ...
-
bioRxiv - Neuroscience 2019Quote: ... O4 (1:500, R&D Systems), MBP (1:50 ...
-
bioRxiv - Neuroscience 2019Quote: ... Nanog (1:100, R&D Systems), TRA1-60 (1:100 ...
-
bioRxiv - Genetics 2020Quote: ... 1:50 (R&D Systems, IC25062V), (2 ...
-
bioRxiv - Bioengineering 2020Quote: ... CD31 (1:100; R&D systems), α-bungarotoxin (1:100 ...
-
bioRxiv - Neuroscience 2021Quote: ... NEP (1:500, R&D Systems), IDE (1:1,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 μM CHIR99021 (R&D Systems) and 0.25mM (day 1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Robo2 (R&D Systems, 1:500), Actin (Sigma ...
-
bioRxiv - Developmental Biology 2022Quote: ... GLI3 (1:1000; R&D Systems), SUFU (1:1000 ...
-
bioRxiv - Immunology 2022Quote: ... PD-1 Ig (R&D Systems), CTLA-4 Ig (Abatacept ...
-
bioRxiv - Bioengineering 2022Quote: ... ICAM-1 (R&D Systems; BBA3), Ki67 (Abcam ...
-
bioRxiv - Neuroscience 2021Quote: ... Tag1 (1:200, R&D Systems), NFM (1:1000 ...
-
bioRxiv - Neuroscience 2021Quote: ... Alcam (1:200, R&D Systems), Lhx9 (1:50 ...
-
bioRxiv - Neuroscience 2021Quote: ... Robo3 (1:500, R&D Systems), Tag1 (1:200 ...
-
bioRxiv - Pathology 2020Quote: ... FOXFI (1:100, R&D Systems), HOPX (1:100 ...
-
bioRxiv - Pathology 2020Quote: ... EMCN (1:200, R&D Systems), FOXFI (1:100 ...
-
bioRxiv - Cancer Biology 2019Quote: ... SOX2 (1:500, R&D Systems), p75NTR (1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lrig1(1:500, R&D System), Lef1 (1:200) ...
-
bioRxiv - Neuroscience 2020Quote: ... (R&D Systems, #AF1056, 1:500), goat polyclonal anti-TRPV1 (R&D Systems ...
-
bioRxiv - Developmental Biology 2020Quote: ... GLI3 (1:1000; R&D systems); P27 (1:1000 ...
-
bioRxiv - Molecular Biology 2021Quote: ... SB290157 (R&D Systems, 1 μM), were added to the medium 2 days before induction and included in the maintenance media when necessary ...
-
bioRxiv - Neuroscience 2023Quote: ... Sparc (1:200, R&D Systems), Sema3a (1:200 ...
-
bioRxiv - Neuroscience 2023Quote: ... Hevin (1:200, R&D Systems), Sparc (1:200 ...
-
bioRxiv - Developmental Biology 2023Quote: ... SOX17 (1:100, R&D systems). Samples were rocked overnight at 4°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... CD31/PECAM-1 (R&D Systems; catalog number ...
-
bioRxiv - Developmental Biology 2023Quote: ... (R&D systems; AF743; 1:400) and GFP (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:100 (R&D system, #AF2864); chicken MAP2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1:10,000 (R&D Systems MAB9205); anti-GFP ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 (R&D Systems; MAB3314); goat anti-OLIG2 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:200 (R&D Systems, AF2418); rat anti-RFP ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...