Labshake search
Citations for R&D Systems :
1151 - 1200 of 3509 citations for Son of sevenless homolog 1 SOS1 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Donkey anti-rabbit RedX conjugated secondary antibody was purchased from R&D Systems (Minneapolis, MN).
-
bioRxiv - Bioengineering 2024Quote: The antibodies used in this study included anti-podocalyxin (AF1658, goat, R&D Systems, Inc), anti-E-Cadherin (ab11512 ...
-
bioRxiv - Cell Biology 2020Quote: ... Recombinant mouse ICAM-1-Fc and VCAM-1-Fc were purchased from R&D Systems. Antibodies for flow cytometery were from BioLegend ...
-
bioRxiv - Neuroscience 2021Quote: ... goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R&D Systems; Cat. No. AF4534); and mouse anti-neurofilament protein (2H3 ...
-
bioRxiv - Cell Biology 2021Quote: We quantified ET-1 levels using the Endothelin-1 Quantikine ELISA kit (R&D systems). First we diluted the media 1/125 in the appropriate buffer and used 75 μL of the dilution for the assay ...
-
bioRxiv - Systems Biology 2020Quote: ... goat anti-PDGFRα (1:200, R&D Systems; mouse anti-APC (CC1; 1:300, Millipore); rabbit anti-GFAP (1:300 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and appropriate Alexa Fluor (Thermo 1:200) and Northern Lights (R&D Systems 1:200) conjugated secondary antibodies were incubated for 2 hours at 37ºC ...
-
bioRxiv - Bioengineering 2020Quote: ... STRO-1 (1:100, animal poly- or mono-, R&D System, Inc., Minneapolis, MN, USA) and the extracellular markers anti-integrin β1 (1:50 ...
-
bioRxiv - Cancer Biology 2021Quote: ... NKp46 (1:175, HIER 1, monoclonal mouse, clone 195314, R&D Systems, USA; MAB1850-500), FoxP3 (1:100 ...
-
bioRxiv - Pathology 2021Quote: Endothelin-1 ELISA was performed on plasma using Endothelin-1 Immunoassay kit (R&D Systems) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and SorCS2 (R&D systems, AF4237, 1:1000 in WB and 1:100 in ICC).
-
bioRxiv - Molecular Biology 2021Quote: ... and MCP-1 (CCL2 /JE/MCP-1 ELISA kit, R&D Systems Inc., Minneapolis, MN) in mouse serum ...
-
bioRxiv - Neuroscience 2020Quote: ... goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R&D Systems; Cat. No. AF4534), and guinea pig anti-SCIP (1/16,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... human/mouse GLI-1 affinity purified polyclonal (1:100; AF3455, R&D systems, RRID: AB_2247710), RUNX2 (27-K ...
-
bioRxiv - Neuroscience 2024Quote: ... goat anti-FORKHEAD BOX PROTEIN 1 (FOXP1) (1/100; R&D Systems; Cat. No. AF4534); mouse anti-neurofilament protein (2H3 ...
-
bioRxiv - Cell Biology 2024Quote: ... were coated with VCAM-1 (1 µg/mL) (cat no. 862-VC; R&D Systems) overnight at 4 °C.
-
bioRxiv - Cell Biology 2022Quote: ... anti-m/rCD31/PECAM-1 Alexa Fluor 488 Conjugated (1:50, FAB3628G; R&D Systems); Claudin-5 (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... 50 μL/well of a 1:1 solution of H2O2 (R&D Systems, part #895000) and tetramethylbenzidine (R&D Systems ...
-
bioRxiv - Molecular Biology 2024Quote: ... Semiconfluent (50-70%) cultures were stimulated with 1-7 μg/ml anti-TREM2 (1:1 anti-TREM2 R&D systems AF1729; anti-TREM2 R&D MAB17291) for 5 minutes at 37ºC in the presence of 1% dimetilsulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/mL recombinant human insulin-like growth factor 1 (IGF-1) (R&D Systems, USA), and 10 μM SB431542 (Tocris ...
-
CAP1 and cofilin1 cooperate in neuronal actin dynamics, growth cone function and neuron connectivitybioRxiv - Neuroscience 2020Quote: ... 50 nM Semaphorin 4D (Thomas Worzfeld lab) or 1 µg/µl Slit-1 (R&D System) for 60 min ...
-
bioRxiv - Cell Biology 2022Quote: ... DPP4 (IF/FACS 1:100, #HBB3/775/42, DSHB; EM 1:10, #AF1180, R&D Systems), E-Cadherin (IF 1:200 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells in PBS were mixed 1:1 with Cultrex TM (R&D systems, Minneapolis, MN, USA) at a final concentration of 1 x 106 in 100 μl prior to injection ...
-
bioRxiv - Cell Biology 2022Quote: ... specifically: goat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1)/CD31 (R&D Systems), mouse anti-mouse α-smooth muscle actin (αSMA ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse mAb to βIII-tubulin conjugated to Alexa488 (Clone Tuj-1, R&D Systems, 1/500), mouse mAb to HNK-1 described previously ((Tucker et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... rabbit IgG (#ab105C; 1:1000) and goat IgG (#ab108C; 1:200) were from R&D Systems. Secondary conjugated polyclonal donkey anti-rabbit IgG Alexa 594 (#A-21206 ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...
-
bioRxiv - Bioengineering 2021Quote: ... the slides were incubated in 5 μg/mL solution of anti-SOX2 antibodies (R&D Systems) or 5 μg/mL solution of anti-Sox17 (SantaCruz ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies for immunoprecipitation and Western blotting included anti-V5 and anti-His (R&D systems), Mouse anti-VAMP2 (SySy Synaptic Systems ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then stained with phycoerythrin (PE)-conjugated anti-sheep secondary antibody IgG (F0126, R&D systems). Cell sorting was conducted on a BD FACSAria IIu cell sorter (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2020Quote: The following primary antibodies were used in Western blotting experiments: anti-MTf (R&D systems, MAB8175), CD63 (Abcam ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated in different concentrations of goat anti-mouse Nrp1 antibody (R&D Systems, AF566) or 1 μg/mL of goat anti-mouse PDGFRα antibody (R&D Systems ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Immunology 2020Quote: The following primary antibodies were used for flow cytometry: anti-MICA (clone 159227; R&D Systems) and anti-MICB (clone 236511 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...
-
bioRxiv - Cancer Biology 2020Quote: ... For westerns we used a monoclonal anti-human PRL antibody (R&D System, Minneapolis, MN, USA), rabbit anti-STAT5 (phospho Y694 ...
-
bioRxiv - Microbiology 2020Quote: ... we then stained with 2 μg of anti-ACE2 goat IgG antibody (R&D Systems, AF933) per million cells followed by a FITC-conjugated secondary antibody (Santa Cruz Biotechnology ...
-
bioRxiv - Immunology 2020Quote: ... inhibition experiment was performed in the presence of anti-DC/L-SIGN antibody (R&D Systems). Cells were then washed as described above ...
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Bioengineering 2023Quote: ... collected hydrogels from the device were stained with Human/Mouse E-Cadherin Antibody (R&D Systems) at a final concentration of 5 µg/mL ...