Labshake search
Citations for R&D Systems :
1151 - 1200 of 1736 citations for Dengue Virus Serotype 4 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were preincubated for 10min with 30µg rat anti-human neuropilin1 Fc chimera (R&D System) or 20µg goat anti-human neuropilin2 Fc chimera (R&D System ...
-
bioRxiv - Neuroscience 2020Quote: ... cell media included RPMI-1640 Glutamax (Life-Technologies) supplemented with 10% FBS (R&D Systems/biotechne), 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... The level of IL-1β in cell culture supernatants was measured using ELISA (R&D systems) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Immunology 2022Quote: ... cells were cultured with Areg (R&D Systems, #989-AR-100, 10 or 100 ng/ml) or heptelidic acid (Adipogen ...
-
bioRxiv - Immunology 2022Quote: ... Non-pathogenic Th17 cell differentiation was performed with IL-6 (25 ng/mL, R&D Systems) and TGF-β1 (2 ng/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were exposed for 2 days to human Activin A (8 ng/ml, R&D Systems) and human bone morphogenetic protein 4 (hBMP4 ...
-
bioRxiv - Cancer Biology 2022Quote: Medium from cells was harvested and used in the Human Cytokine Array Kit (R&D Systems), as per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK 293T cells were seeded on plates coated with Cultrex Poly-L-Lysine (R&D Systems) prior to transfection with the pCCl-c-MNDU3 STEAP1-BBζ CAR lentiviral plasmid and the packaging plasmids pMDL ...
-
bioRxiv - Cancer Biology 2022Quote: ... cells were changed into fresh media supplemented with DMSO or 600ng/mL IFNγ (R&D Systems) and incubated for 48 hours ...
-
bioRxiv - Immunology 2021Quote: ... the INS-1 cells were treated with recombinant mouse IFNγ (1000 units/mL; R&D Systems) and recombinant human IL-1β (50 units/mL ...
-
bioRxiv - Neuroscience 2020Quote: Mouse myelogenous leukemia (M-NFS-60) cells were M-CSF (R&D systems, 216-MC/CF) starved for 24 hours ...
-
bioRxiv - Neuroscience 2021Quote: ... Sox2 was used as a neuronal stem cell marker (mouse, MAB2018, R&D Systems, 1:100), Tuj1 (mouse ...
-
bioRxiv - Microbiology 2020Quote: ... Cells or organoids were stimulated with IFN-α2 (500 U/ml, R&D systems 11100-1), IFN-β (500 U/ml ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then fixed and immunolabeled using goat anti-Lumican (R&D Systems, AF2745, 1:200) and donkey anti-goat IgG Alexa555 (Invitrogen ...
-
bioRxiv - Pathology 2021Quote: ... the cells were incubated with an anti-myosin heavy chain (MHC) (#MAB4470, R&D Systems,MN) (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were stimulated with increasing amounts of IFNs (α2 (R&D Systems, Cat#11101-2), β (R&D Systems ...
-
bioRxiv - Cell Biology 2021Quote: ... placental cell clusters were pretreated for 30 min with anti-NRP1 mAb (R&D Systems, AF3870) or anti-ACE2 mAb (Agilent ...
-
bioRxiv - Immunology 2021Quote: ... and IL-1ß in the cell-culture supernatants were measured by ELISA (DIF50; R&D Systems) and using bead-based immunoassay (740929 ...
-
bioRxiv - Immunology 2021Quote: ... Th0 cell cultures were provided IL-2 (15 U/mL; R&D Systems 202-IL-500), while Th17 cell cultures were supplemented with IL-6 (20 ng/mL ...
-
bioRxiv - Immunology 2021Quote: ... nitrite concentrations in cell culture supernatant were determined via Griess reaction assay kit (R&D Systems).
-
bioRxiv - Immunology 2021Quote: ... Cells were treated with 10 ng/ml recombinant mouse TNFα (410-TRNC-010, R&D Systems) diluted in the media as described above.
-
bioRxiv - Microbiology 2020Quote: ... Detached cells were labelled with a mouse anti-ACE2 antibody (R&D Systems, Minneapolis, MN1/200) followed by an Alexa488 goat anti-mouse (1:1,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were transferred to a new plate with fresh medium and IL-23 (R&D Systems). After 48 hours rest ...
-
bioRxiv - Immunology 2022Quote: ... and/or cells were activated with recombinant human IL-12 and IL-18 (R&D Systems), or IL-2 and IL-33 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Slides were processed with a commercial DAB cell and tissue staining kit (#CTS019, R&D Systems). Primary antibody immunostaining was optimised for polyclonal rabbit anti-human peroxidasin (#abx101905 ...
-
bioRxiv - Cell Biology 2022Quote: ... specifically: goat anti-mouse platelet-endothelial cell adhesion molecule-1 (PECAM-1)/CD31 (R&D Systems), mouse anti-mouse α-smooth muscle actin (αSMA ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... Cells were co-stained with a rabbit anti-human VE-Cadherin (1:100, R&D Systems). Secondary antibodies included Alexa Fluor 488 donkey anti-mouse IgG and Alexa Fluor 546 donkey anti-rabbit IgG (both 1:200 ...
-
bioRxiv - Neuroscience 2024Quote: ... and 2 ng/ml glial cell-derived neurotrophic factor (GDNF, R&D Systems, Minneapolis, MN, USA). The experiments were conducted on flasks or multi-well plates (Nunc ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated with recombinant human IL1β (208-IL-010, R&D Systems, Minneapolis, MN, USA) for 30 min before immunofluorescence ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were treated with either BSA or human recombinant WNT3a (5036-WN-010, R&D Systems) 24 hours later ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells in PBS were mixed 1:1 with Cultrex TM (R&D systems, Minneapolis, MN, USA) at a final concentration of 1 x 106 in 100 μl prior to injection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were stained with Human CD46 Alexa Fluor 594-conjugated Antibody (R&D systems FAB2005T-1). Alexa Fluor 594 signal was detected with a 561 nm yellow laser and a 585/16 bandpass emission filter ...
-
bioRxiv - Bioengineering 2023Quote: P4 MSCs were assessed using the Human Mesenchymal Stem Cell Functional Identification Kit (R&D System) following the product instruction ...
-
bioRxiv - Bioengineering 2023Quote: P4 MSCs were characterized with the Human Mesenchymal Stem Cell Verification Flow Kit (R&D Systems), including antibodies for positive markers CD90 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were harvested and lysed by lysis buffer provided in the kit (R&D Systems, #895943). The supernatant was collected after centrifugation at 14,000xg for 5 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: Cytokine analysis of host cell culture supernatants was performed using DuoSet ELISA kits (R&D Systems) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell pellets were resuspended in 70% basement membrane extract (BME) (R&D Systems, #3533-010-02). Each droplet of cell clusters contained roughly ∼2,000 cells/ 50uL ...
-
bioRxiv - Immunology 2023Quote: ... The cell monolayer was then stimulated with 6.25U/mL IL-1β (R&D systems, Minneapolis, MN) for 4h at RT to upregulate E-selectin ...
-
bioRxiv - Bioengineering 2023Quote: ... B cell activating medium was supplemented with 5 ug/mL anti-CD40 antibody (R&D systems) and 20 ng/mL IL-4 (R&D Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 40 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell lysates were then incubated with 2 μg of anti-galectin-9 (AF2545, R&D systems) or isotype control under rotation ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 ng/mL glial cell line-derived neurotrophic factor (GDNF; R&D systems, catalog #: 212-GD), and 10 µM ROCK inhibitor Y27632 (HelloBio ...
-
bioRxiv - Cell Biology 2023Quote: ... Those cells were washed and subsequently resuspended in Cultrex BME (Cat. No. 343300501, R&D Systems) and plated in 20-25 µl droplets of Cultrex ...
-
bioRxiv - Immunology 2023Quote: ... single cell suspensions were stained with a goat anti-galectin-9 antibody (AF2045, R&D systems) at 8 μg/ml or isotype control as negative control for 30 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with or without 10 ng/ml TGFβ (R&D Systems, Cat. # 240-B) for another 24 hr and harvested for RNA extraction after 72 hr.
-
bioRxiv - Microbiology 2024Quote: ... further cells were treated with 1000 U IFN-β (R&D Systems, #8499-IF-010/CF). 24 h post-treatment whole-cell lysates for SDS-PAGE and immunoblotting were prepared.
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The transfected HTLA cells were split into a poly-L-lysine (R&D systems, Minneapolis, MN) coated 96-well white clear bottom cell culture plates (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2024Quote: ... FL5.12 cells were cultured in the presence of 10 ng/ml IL-3 (R&D Systems). Cell cycle exit in FL5.12 was achieved by washing the cells three times with PBS to remove IL-3 from the cells and by placing the cells in IL-3 free culture media for 48 h ...