Labshake search
Citations for R&D Systems :
1051 - 1100 of 1746 citations for 14 3 3 Zeta YWHAZ Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The following primary antibodies were used: anti-GCA (catalog#MAB48601, R&D System, Minneapolis, MN) at 1:1000 dilution ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were incubated with primary antibodies against Aldh1a1 (goat, R&D Systems Cat# AF5869, RRID:AB_2044597), TH (mouse ...
-
bioRxiv - Neuroscience 2022Quote: Stimulation of organotypic slices with TNFα neutralizing antibody (1 μg/ml, R&D systems, MAB4101) was performed at DIV18-21 in pre-warmed aCSF (aCSF ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Glypican 1 (GPC-1) biotinylated antibody was purchased from R&D systems (MN, USA). Biotinylated anti-CD63 ...
-
bioRxiv - Cancer Biology 2024Quote: ... whole blood samples were incubated with biotinylated antibodies against CD45 (R&D Systems, clone 2D1), CD66b (AbD Serotec ...
-
bioRxiv - Developmental Biology 2024Quote: The following antibodies were used: goat anti-PDGFR alpha 1: 200 (R&D Systems, AF1062), mouseanti-EZRIN 1:1000 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunofluorescence staining on these sections involved primary antibodies against anti-CD45 (AF114, R&D Systems), Biotin-conjugated anti-podoplanin (127403 ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunocytochemistry was performed with primary antibody mouse anti-β(III)-Tubulin (R&D Systems, MAB1195) 1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with Mouse CXCL10 antibody (R&D Systems AF-466-609 NA, Minneapolis MN). TNF-α and IL-1β were measured in the supernatant by ELISA with Mouse TNF-α Quantikine ELISA Kit (R&D Systems MTA00B ...
-
bioRxiv - Microbiology 2023Quote: ... and then anti-goat horseradish peroxidase-conjugated antibody (Catalog #HAF017, R&D Systems, Minneapolis, MN) was added at 1:1000 dilution at room temperature for 1 hour ...
-
bioRxiv - Cancer Biology 2023Quote: A membrane-based antibody array (Proteome Profiler Human Cytokine Array Kit, R&D Systems, ARY005B) was used to profile 36 soluble proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... sections were analyzed using rabbit polyclonal antibodies against CD31 (AF3628-R&D Systems, 1:30) and α-smooth muscle actin (α-SMA ...
-
bioRxiv - Cancer Biology 2023Quote: Neutralizing BMP6 antibodies (MAB507 for human, MAB6325 for mouse) were purchased from R&D system. LDN214117 (S7627 ...
-
bioRxiv - Immunology 2023Quote: ... and were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Immunology 2023Quote: ... cells were partially pre-stimulated with neutralizing IL1R1 antibody (1:100, R&D Systems, USA) for 1h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then incubated with anti-MHC antibody (MHC; R&D Systems, Minneapolis, MN, USA) (1:400) ...
-
bioRxiv - Cancer Biology 2023Quote: ... The following antibodies were used: Anti-mouse IFNγ (R&D systems, Cat. No. IC485F-025), anti-mouse IL12 (BioLegend ...
-
Targeting adipocyte ESRRA promotes osteogenesis and vascular formation in adipocyte-rich bone marrowbioRxiv - Molecular Biology 2023Quote: ... or CD31/PECAM-1 Alexa Fluor 488-conjugated Antibody (1:200; R&D system #FAB3628G). After primary antibody incubation ...
-
bioRxiv - Physiology 2023Quote: ... primary antibodies of 1:200 Goat anti-CD31 (R&D systems, U.K, goat anti-PECAM1) and 1:500 anti-desmin (Abcam ...
-
bioRxiv - Developmental Biology 2023Quote: ... Slides were incubated overnight with goat anti-human IGF-II antibody (R&D Systems; AF292). Alexa Fluor® 488-AffiniPure antibody (Jackson ImmunoResearch ...
-
bioRxiv - Neuroscience 2023Quote: ... by using a cocktail of antibodies: goat anti-podocalyxin (1:1500, AF1556, R&D Systems), goat anti-CD31 (1:300 ...
-
bioRxiv - Biochemistry 2022Quote: Antibodies used for flow cytometry included: mouse anti-human FAP-APC (R&D Systems, FAB3715A), sheep anti-human FAP (R&D Systems ...
-
bioRxiv - Developmental Biology 2023Quote: The following antibodies were used: goat anti-PROX1 (Cat#: AF2727, R&D Systems, 1:100), rat anti-Endomucin (Cat# ...
-
bioRxiv - Immunology 2023Quote: ... antibody was purchased from Invitrogen and monoclonal anti-mouse Axl antibody (clone 175128) from R&D Systems (Minneapolis, MN, USA). Polyclonal anti-mouse LXRα antibody (#ab3585 ...
-
bioRxiv - Neuroscience 2023Quote: The primary antibodies used for immunostaining were goat anti-Pdgfrα (1:250, R&D Systems), rabbit anti-Pdgfrα (1:250 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or monoclonal antibody to human POSTN (R&D Systems, Cat # AF3548, at 10 µg/mL), or anti-human IgG (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10 μL intramuscular injection of Spp1 neutralizing antibody (4 μg, AF808, R&D Systems) was administered into the tibialis anterior (TA ...
-
bioRxiv - Genetics 2024Quote: ... the tubules were incubated with primary antibodies against cKit (1:1000 R&D systems AF1356), DNMT3a (1:1000 Imgenex IMG-268A ...
-
bioRxiv - Neuroscience 2023Quote: ... The following antibodies were used: mouse anti-IGFBP3 (R&D systems, MAB305-100, 1:200), rabbit anti-PAI1/SERPINE1 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... the nuclei were then stained with anti-SOX10 antibody (R&D Systems, AF2864, 1:250) + anti-Goat AF488 (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... Further incubations with anti-VEGFR2 N-terminal antibody (rabbit, 1:100, R&D Systems, USA) and goat anti-rabbit IgG H+L Alexa Fluor 488 (1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-REL2 mouse monoclonal antibody (part # 844036) from the ELISA kits (R&D system) were used as capture antibodies for the enrichment of REL1 and REL2 proteins from cell lysate and clinical samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... Secondary antibody was added for ULBP 1 and 2/5/6 only (R&D Systems). Cells were then washed and fixed in 4% paraformaldehyde ...
-
bioRxiv - Microbiology 2024Quote: ... Primary antibody against advanced glycosylation end-product specific receptor (AGER, R&D Systems, 1:250), pro-surfactant protein C (pro-SFTPC ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 0.1% Triton X-100 before staining with antibodies for KDR (R&D Systems #AF644), CD45 (BD Biosciences #550539) ...
-
bioRxiv - Bioengineering 2024Quote: ... Secondary antibody Donkey Anti-Goat IgG NL637 Affinity Purified PAb (#NL002, R&D Systems Inc) at a concentration of 20 μg/mL was added to the tissue section and incubated for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2024Quote: ... Antibodies used were as follows: PKR: anti-PKR (human) monoclonal (71/10, R&D Systems), p-eIF2α ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell cultures were immunolabelled with O4 antibody diluted 1:200 (R&D Systems, Oakville, ON) for one hour ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibodies were used in immunostaining: Anti-FOXA2 (R&D systems, #AF2400; 1:100), Anti-OLIG2 (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... We used following primary antibodies and dilutions: anti-(murine)SorCS2 1:1000 (#AF4237, R&D Systems), anti-DARPP-32 1:1000 (#AB40801 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the following primary antibodies were used: mouse anti-human IFN-γ (R&D system, 1:1000), mouse anti-human ICAM1 (Abcam ...