Labshake search
Citations for R&D Systems :
9951 - 10000 of 10000+ citations for 7 Amino 1 3 dimethyl 1H 8H pyrido 2 3 d pyrimidine 2 4 5 trione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Secondary antibodies conjugated to horseradish peroxidase (HRP) are from R&D systems (HAF007 and HAF008). HRP was detected using Supersignal West Pico Plus Chemiluminescent Substrate (Fisher #34577 ...
-
bioRxiv - Microbiology 2024Quote: ... IFN-γ and CFH comprised a goat-anti-mouse IgG antibody (M8642, R&D systems), for NCAM and serpin-A3 ...
-
bioRxiv - Biophysics 2024Quote: ... with 10% v/v heat-inactivated fetal bovine serum (FBS) (R&D Systems, Cat#S11550), 50 U/mL Penicillin-Streptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... mouse Fibroblast Growth Factor 23 from R&D systems (FGF23, 2629-FG-025, Minneapolis, MN). ChIP antibody for VDR (C-20 ...
-
bioRxiv - Immunology 2024Quote: ... were thawed in RPMI 1640 (Cytiva) supplemented with 10% fetal bovine serum (R&D Systems) and 100 U/mL Penicillin-Streptomycin and then conditioned for growth in OpTimizer T cell expansion media (Gibco ...
-
bioRxiv - Immunology 2024Quote: ... The mouse anti-human DCIR-Alexa Fluor 405 (216110) was purchased from R&D Systems.
-
bioRxiv - Immunology 2024Quote: ... supernatants were collected and proteins levels were quantified by sandwich ELISA (DuoSet R&D Systems) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... IL-10 and RANTES in the supernatants was determined using ELISA kits (R&D Systems) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2024Quote: ... The cells were exposed to 10 ng/mL of TGFβ1 (R&D systems, Minneapolis, MN) for a period of up to 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVECs were basally stimulated with 10 ng/ml TNF-α (R&D Systems, 210-TA) for 18 hours ...
-
Differentiation Protocol-Dependent Variability in hiPSC-Derived Endothelial Progenitor FunctionalitybioRxiv - Bioengineering 2024Quote: ... and 50 ng/mL Vascular Endothelial Growth Factor (VEGF, R&D Systems, 203-VE-050). Differentiation Media supplemented with these factors was replaced daily for 2 additional days.
-
bioRxiv - Immunology 2024Quote: ... and its respective isotype control antibody (2.1 μg/mL; R&D Systems, AB-105-C). Additional Protein A Agarose/Salmon Sperm DNA beads were added to collect the DNA/histone complex ...
-
bioRxiv - Immunology 2024Quote: Commercially available recombinant 293 cells derived human BTN2A2-Fc (Cat# 8918- BT; R&D systems) and mouse BTN2A2 (Cat# 8997-BT-050 ...
-
bioRxiv - Immunology 2024Quote: ... Protein concentrations were determined using a Magnetic Luminex Multiplex assay (custom designed, R&D Systems), as described in the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Donkey anti-rabbit RedX conjugated secondary antibody was purchased from R&D Systems (Minneapolis, MN).
-
Differentiation Protocol-Dependent Variability in hiPSC-Derived Endothelial Progenitor FunctionalitybioRxiv - Bioengineering 2024Quote: ... we used a Proteome Profiler Human Protease/Protease Inhibitor Assay Kit (R&D Systems, ARY025) using the recommended protocol for cell supernatant ...
-
bioRxiv - Cancer Biology 2024Quote: Nuclear RFP-stained melanoma cells were seeded with IFNγ (R&D Systems, #285-IF-100) in 96-well plates and incubated overnight at 37°C and 5% CO2 to allow them to attach ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines underwent DNA fingerprint (STR) confirmation and routine mycoplasma testing (R&D Systems CUL001B) via Fred Hutch Research Cell Bank Services.
-
bioRxiv - Cell Biology 2024Quote: ... the cells were induced with 25 ng/mL M-CSF (R&D Systems, Abingdon, UK), after cells were induced with 25 ng/mL M-CSF and 25 ng/mL RANKL (R&D Systems ...
-
bioRxiv - Cell Biology 2024Quote: ... pH 7.9) containing 10 μM of HA-Ub-VS (R&D Systems, cat. #U-212). Reaction mixtures were incubated at 37°C for 2 hours and quenched by addition of 10 μl of 4X sample buffer ...
-
bioRxiv - Bioengineering 2024Quote: The antibodies used in this study included anti-podocalyxin (AF1658, goat, R&D Systems, Inc), anti-E-Cadherin (ab11512 ...
-
bioRxiv - Cell Biology 2024Quote: ... N2B27 medium was supplemented with 250nM LDN193189 and with 10ng/mL FGF2 (R&D Systems) until day 15 of differentiation ...
-
bioRxiv - Cancer Biology 2024Quote: ... Mouse serum cytokines were analyzed by a custom Luminex-based multiplex assay (R&D Systems) for mouse CXCL1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Fetuin-A was quantified using the mouse Fetuin-A/AHSG DuoSet ELISA (R&D Systems) according to the manufacturer’s instructions (Control n=7 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cytokines level were measured using either the Proteome Profiler Human XL Cytokine array (R&D Systems) or Quantikine ELISA kits for dedicated cytokines (R&D Systems) ...
-
bioRxiv - Cell Biology 2020Quote: ... plasma (n=11-47) or BALF (n=6-19) by ELISA (R&D systems, Minneapolis, USA). Active TGFβ1 was quantified by a Mink lung epithelial cell (MLEC ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... This TS base media was supplemented with 25 ng/mL FGF4 (R&D Systems 235-F4) and 1 µg/ml heparin (Sigma-Aldrich H3149) ...
-
bioRxiv - Cell Biology 2020Quote: ... mOSE cells were plated 24hrs prior to the addition of TGFB1 (10ng/mL, R&D Systems) and cells were collected after 4 days of treatment ...
-
bioRxiv - Immunology 2021Quote: The assay was performed following the manufacturer’s instructions (R&D systems, mouse IFNγ Kit Cat # EL485). In short IFNγ ELISpot analysis was performed ex vivo (without further in vitro culturing for expansion ...
-
bioRxiv - Cell Biology 2020Quote: ... human CXCL1/GROα duo-set or CCL5 duo-set or IGFBP3 duo-set (R&D Systems) were used to detect the concentrations of CXCL1 or CCL5 or IGFBP3 in the plasma following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Cell Biology 2020Quote: ... human CXCL1/GROα duo-set or CCL5 duo-set or IGFBP3 duo-set (R&D Systems) were used to detect the concentrations of CXCL1 or CCL5 or IGFBP3 in the CM following manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Levels of IL-1β or TNF in cell supernatants were quantified by ELISA (R&D Systems).
-
bioRxiv - Immunology 2021Quote: ... recombinant mouse IL-15Rα-Fc and recombinant human IL-15 were purchased from R&D Systems. For each mouse ...
-
bioRxiv - Developmental Biology 2021Quote: ... and qNSC induction was performed with 50 ng/ml BMP4 (R&D Systems 5020-BP-010). qNSCs cultures were never passaged ...
-
bioRxiv - Developmental Biology 2020Quote: Western blot studies were performed as described earlier using an anti-GLI2 (#AF3635; R&D Systems) antibody (Wang et al. ...
-
bioRxiv - Physiology 2022Quote: ... IL-6 (DY-406) and Ccl2 (DY-479) according to the manufacturer’s manual (R&D Systems). Briefly ...
-
bioRxiv - Biochemistry 2022Quote: ... media were supplemented with 10% heat-inactivated fetal bovine serum (R&D Systems, S11150H, Lot. H19109). Cells were cultured at 37 °C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... A standard curve was established by applying known titers of recombinant IFN-α2a (R&D Systems) onto STING-37 cells ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Sections were first incubated with an antigen retrieval solution (Antigen Retrieval Reagent-Basic, R&D Systems) at 80°C for 30 minutes followed by blocking (2% non-fat dry milk ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Progranulin protein levels were measured using a human-specific ELISA (Quantikine and DuoSet; R&D Systems) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... the cultured neurospheres were collected and re-plated onto the Poly-L-Ornithine (R&D systems) and Laminin (Corning)-coated coverslips to form a monolayer culture ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant mouse macrophage colony stimulating factor (rm-MCSF) was from R&D System (Cat. # 416-ML). Human highly oxidized LDL was obtained from KB Kalen Biomedical (Cat ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supernatants were collected and cytokine levels were assessed by ELISA kit (R&D Systems, Minneapolis, MN) for IFN-γ ...
-
bioRxiv - Neuroscience 2020Quote: ... Levels of C-reactive protein (CRP) were determined using a commercial ELISA kit (R&D Systems). Plasma levels of total cholesterol ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were preincubated for 10min with 30µg rat anti-human neuropilin1 Fc chimera (R&D System) or 20µg goat anti-human neuropilin2 Fc chimera (R&D System ...