Labshake search
Citations for R&D Systems :
9901 - 9950 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... SR-BI and EphA2 preys were captured from expression supernatant onto a white 96 well plate coated with cognate mAbs (1D6 [Abcam] for CD81, EP1556Y [Abcam] for SR-BI, MAB3035 [R&D Systems] for EphA2), with supernatant containing CD200 prey used as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... concentrations was performed on CSF samples of the discovery and validation cohort as well as a subset of plasma samples of the validation cohort using Quantikine® ELISA kits (R&D Systems, Minneapolis, MN, US). The experiments were performed according to the manufacturer’s instruction.
-
Direct intracellular visualization of Ebola virus-receptor interaction by in situ proximity ligationbioRxiv - Microbiology 2020Quote: ... or recombinant human cathepsin L (CatL, 2 ng/ul, pH 5.5, 37°C for 1h; R&D Systems) as described previously (5) ...
-
Direct intracellular visualization of Ebola virus-receptor interaction by in situ proximity ligationbioRxiv - Microbiology 2020Quote: ... incubated with the fluorogenic peptide substrate Z-FR-AMC (150 μM; R&D Systems) and measured at a fluorometer following a 0 to 30 min incubation (ƛEx = 390 nm ...
-
bioRxiv - Microbiology 2020Quote: ... Cytokines were quantified by enzyme-linked immunosorbent assay following the manufacturer’s protocol (R&D Systems). Expression was examined in cells lysed with RIPA (Millipore) ...
-
bioRxiv - Microbiology 2020Quote: ... Loading for IL-1R reporter assays was normalized by total IL-1β product measured by enzyme-linked immunosorbent assay (R&D Systems).
-
bioRxiv - Microbiology 2020Quote: ... 100 ng/mL rIL-1β (R&D Systems), 5 µM caspase inhibitors zVAD-fmk ...
-
bioRxiv - Microbiology 2020Quote: ... and IETD-fmk (R&D Systems), 10 µg/mL complete protease inhibitor cocktail (Roche) ...
-
bioRxiv - Systems Biology 2020Quote: ... culture medium was replaced with fresh medium supplemented with 4.0 ng/ml TGF-β (R&D Systems 240-B) for 1-3 days to induce EMT ...
-
bioRxiv - Microbiology 2020Quote: ... fourth weeks of infection were collected to evaluate the concentration of MCP-1 and TNF-α by using ELISA kits according to the manufacturer’s protocols (R&D Systems, Rennes, France), the mean minimum detectable dose of human MCP-1 was 1.7 pg/mL and 4.00 pg/mL for human TNF-α ...
-
bioRxiv - Microbiology 2020Quote: ... and then switched to 36-48 h of 10 μM SB431542 and 1 μM IWP2 (R&D Systems) treatment ...
-
bioRxiv - Microbiology 2020Quote: ... and then stained with goat anti-human galectin-8 antibody (R&D Systems, AF1305) diluted in PB solution overnight at 4°C ...
-
bioRxiv - Developmental Biology 2020Quote: ... DYRK1A was inhibited using 5μM harmine (R&D Systems) and DYRK1B was inhibited using 5μM AZ191 (Tocris Bioscience ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were detected on a Li-Cor Odyssey Blot Imager using the following primary and secondary antibodies: anti-IL-1β (R&D systems, AF-201-NA), anti-GFP (Clontech ...
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-ATG12 (Cat# MAB6807) and recombinant mouse IFN-α (Cat #:12100-1) from R&D Systems (Minneapolis, MN 55413, USA). The mouse anti-CHIKV (Clone A54Q ...
-
bioRxiv - Cancer Biology 2020Quote: ... Presence of 105 proteins in supernatants was evaluated using human cytokine and chemokine XL proteome array kit from R&D Systems (Minneapolis, MN).
-
bioRxiv - Cancer Biology 2020Quote: ... Hyaluronan ELISA kit was purchased from R&D Systems. Hyaluronidase 2 polyclonal antibody conjugated with PE or Alexa-488 was obtained from Bioss Antibodies ...
-
bioRxiv - Cancer Biology 2020Quote: ... CMK lines were treated with 200 ng/ml of recombinant human WNT3A (R&D systems) for 4 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Membranes were incubated overnight at 4°C with primary antibodies against pLCK (Y394) (1:1000) (R&D Systems), GAPDH (1:1000 ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-human sFRP-1 and antihuman Dkk-1 antibodies (cat# CCM017; R&D Systems; Minneapolis, MN, USA) for 15 days ...
-
bioRxiv - Cancer Biology 2020Quote: ... Either CD184/CXCR4 conjugated with FITC (R&D Systems; RRID: AB_2091799) or CD117/c-kit conjugated with PE (Miltenyi Biotec ...
-
bioRxiv - Genomics 2020Quote: Plasma was used to assess circulating monocyte chemoattractant protein (MCP)-1 and C-reactive protein (CRP) via ELISA following manufacturer’s instructions (R&D Systems, Minneapolis, MN, USA) (1).
-
bioRxiv - Cancer Biology 2020Quote: ... UCHL1 (MAB6007, R&D Systems), PSMA7 (cat# PA5-22289 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH6.0 at 95°C followed by 1h blocking and incubation with pre-optimized primary anti-UCHL1 (MAB6007, R&D Systems) or anti-p53 (Dako ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 U/ml interferon γ (R&D Systems). All experiments testing the effects of genetic perturbations were carried out at the non-permissive temperature for large T function (39°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... Organoids were cultured in 100% Cultrex® RGF BME (R&D Systems, Minneapolis, USA) covered with DMEM/F12 (1% penicillin-streptomycin and 2mM L-Glutamine ...
-
bioRxiv - Cancer Biology 2020Quote: ... and human XL oncology array kit (R&D Systems, Proteome profiler, Cat. No: ARY026), which detects 84 human cancer-related proteins (Table S3) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Death-related proteins were measured in cell lysates by a solid-phase antibody array with chemiluminescent detection (R&D Systems, 893900).
-
bioRxiv - Cancer Biology 2020Quote: ... ELISA’s were performed using 50 μl of media per sample and following the manufacturer’s protocol (R&D systems, DTFF30). After removal of media ...
-
bioRxiv - Cancer Biology 2020Quote: ... tissue sections were incubated with anti-TFF3 (R&D Systems, MAB4407, 1:50) overnight at 4°C followed by Alexa Flour anti-mouse 488 (Cell Signaling Technology ...
-
bioRxiv - Cancer Biology 2020Quote: ... IHC score for tumor SDF-1 staining (Clone 79018 R&D Systems, IHC staining details are available in Appendix Supplementary Methods ...
-
bioRxiv - Cancer Biology 2020Quote: ... or collagen III (human, R&D Systems; mouse, Abbexa; rat, Yo Protein). NC410 protein was diluted in assay buffer (ForteBio ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse or rat collagen I (human, R&D Systems; mouse, Ray Biotech; rat, Yo Protein) or collagen III (human ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fixed slices were incubated with goat-anti-mouse CD31 (R&D system, #AF3628, 1:200) and rabbit-anti-FITC (Biorad ...
-
bioRxiv - Cancer Biology 2020Quote: SHP2 phosphatase activity was determined using the human/mouse/rat active DuoSet IC kit (R&D Systems). Briefly ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10ng/mL bFGF (R&D Systems), B27 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: ... anti-PD-L1 PE conjugated (R&D Systems cat no: FAB1561P), anti-PD-L1 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2020Quote: ... CHLA9 and CHLA10 cells were cultured in IMDM +L-glutamine media supplemented with 20% FBS and 1% insulin-selenium-transferrin (ITS, R&D Systems, cat no: AR013). Cell lines were maintained at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were cultured as tumorspheres in Neurobasal medium supplemented with 10ng/mL EGF (R&D Systems, Minneapolis MN), 10ng/mL bFGF (R&D Systems) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and MSP from R&D Systems (cat # 4306-MS-010). Halt protease and phosphatase inhibitor (PPI ...
-
bioRxiv - Cancer Biology 2020Quote: ... LXRα (R&D System, Minneapolis, US - #PP-PPZ0412-00), LXRβ (Active Motif ...
-
bioRxiv - Cancer Biology 2020Quote: ... The secretome for each specimen was profiled using a Proteome Profiler™ Human Angiogenesis Array Kit (Ary007, R&D Systems, Minneapolis, MN) following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat anti-GATA2 (AF2046) (R&D systems). The obtained material was analysed by qPCR on an ABI 7500 real-time PCR System using primers Chr18_5’ ACTCCCCTTTCATGCTTCTGATATCCATT ...
-
bioRxiv - Cancer Biology 2020Quote: ... mouse tumors were homogenized with a tissue homogenizer in 700μL of Cell Lysis Buffer 2 (R&D Systems) containing 1x Halt Protease Inhibitor Cocktail (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Magnetic Luminex Assays were performed with a Mouse Premixed Cytokine/Chemokine Multi-Analyte Kit (R&D Systems) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... goat-anti LMO2 (R&D systems, AF2726), rabbit-anti 53BP1 (Novus Biologicals ...
-
bioRxiv - Cancer Biology 2020Quote: ... with 20ng/ml IL-15 (R&D Systems, Bio-Techne, Lille, France). Cells were incubated or not with various drugs ...
-
bioRxiv - Cancer Biology 2020Quote: ... The relative level of cytokines within the culture supernatant was determined using the Proteome Profiler Mouse Cytokine Array (R&D System, Minneapolis), as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and EGF (50 ng/mL, R&D Systems) was added ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the tissue sections were incubated overnight at 4°C with antibodies against human DDR1 (R&D Systems, AF2396), CXCL5 (Abcam ...