Labshake search
Citations for R&D Systems :
9801 - 9850 of 10000+ citations for 6 AMINO 6 DEOXY 1 2 3 4 DI O ISOPROPYLIDENE D GALACTOPYRANOSIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... mOSE cells were plated 24hrs prior to the addition of TGFB1 (10ng/mL, R&D Systems) and cells were collected after 4 days of treatment ...
-
bioRxiv - Immunology 2021Quote: The assay was performed following the manufacturer’s instructions (R&D systems, mouse IFNγ Kit Cat # EL485). In short IFNγ ELISpot analysis was performed ex vivo (without further in vitro culturing for expansion ...
-
bioRxiv - Cell Biology 2020Quote: ... human CXCL1/GROα duo-set or CCL5 duo-set or IGFBP3 duo-set (R&D Systems) were used to detect the concentrations of CXCL1 or CCL5 or IGFBP3 in the plasma following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Cell Biology 2020Quote: ... human CXCL1/GROα duo-set or CCL5 duo-set or IGFBP3 duo-set (R&D Systems) were used to detect the concentrations of CXCL1 or CCL5 or IGFBP3 in the CM following manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... Levels of IL-1β or TNF in cell supernatants were quantified by ELISA (R&D Systems).
-
bioRxiv - Immunology 2021Quote: ... recombinant mouse IL-15Rα-Fc and recombinant human IL-15 were purchased from R&D Systems. For each mouse ...
-
bioRxiv - Developmental Biology 2021Quote: ... and qNSC induction was performed with 50 ng/ml BMP4 (R&D Systems 5020-BP-010). qNSCs cultures were never passaged ...
-
bioRxiv - Developmental Biology 2020Quote: Western blot studies were performed as described earlier using an anti-GLI2 (#AF3635; R&D Systems) antibody (Wang et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... media were supplemented with 10% heat-inactivated fetal bovine serum (R&D Systems, S11150H, Lot. H19109). Cells were cultured at 37 °C with 5% CO2 ...
-
bioRxiv - Microbiology 2022Quote: ... A standard curve was established by applying known titers of recombinant IFN-α2a (R&D Systems) onto STING-37 cells ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Sections were first incubated with an antigen retrieval solution (Antigen Retrieval Reagent-Basic, R&D Systems) at 80°C for 30 minutes followed by blocking (2% non-fat dry milk ...
-
Genetically engineered microglia-like cells have therapeutic potential for neurodegenerative diseasebioRxiv - Neuroscience 2021Quote: ... Progranulin protein levels were measured using a human-specific ELISA (Quantikine and DuoSet; R&D Systems) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... the cultured neurospheres were collected and re-plated onto the Poly-L-Ornithine (R&D systems) and Laminin (Corning)-coated coverslips to form a monolayer culture ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant mouse macrophage colony stimulating factor (rm-MCSF) was from R&D System (Cat. # 416-ML). Human highly oxidized LDL was obtained from KB Kalen Biomedical (Cat ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Immunology 2019Quote: ... CXCL10 protein was quantified using the Mouse CXCL10 Duoset ELISA kit (R&D Systems; #DY466-05) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... and then stimulated with 60 ng/ml PDGF-AA (rat recombinant, R&D Systems Inc., MN) for specifically indicated (in figures ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... For differentiation of fibroblasts to myofibroblasts 5ng/ml of TGF-β1 (7666-MB, R&D Systems) was used ...
-
bioRxiv - Developmental Biology 2019Quote: ... were selected and transferred to 1mg/ml recombinant human Noggin protein (6057-NG, R&D Systems) in PBS and incubated for 30 minutes to 1 hour at ambient temperature before being implanted in embryos ...
-
bioRxiv - Pathology 2019Quote: ... β-actin mouse mAb (Thermo Fischer Scientific, MA5-15739) and TACE/ADAM17 pAb (R&D Systems, AF9301).
-
bioRxiv - Immunology 2019Quote: ... in the presence of 20% autologous donor sera or 10 ng/ml IFNγ (R&D Systems). PBMCs from healthy donors were placed in M199 medium (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Brain tissue cytokine levels were measured using the Mouse cytokine array Panel A (R&D Systems) following protocols described by the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Cancer Biology 2021Quote: ... supernatants were collected and cytokine levels were assessed by ELISA kit (R&D Systems, Minneapolis, MN) for IFN-γ ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...
-
bioRxiv - Neuroscience 2020Quote: ... Levels of C-reactive protein (CRP) were determined using a commercial ELISA kit (R&D Systems). Plasma levels of total cholesterol ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were preincubated for 10min with 30µg rat anti-human neuropilin1 Fc chimera (R&D System) or 20µg goat anti-human neuropilin2 Fc chimera (R&D System ...
-
bioRxiv - Neuroscience 2020Quote: ... cell media included RPMI-1640 Glutamax (Life-Technologies) supplemented with 10% FBS (R&D Systems/biotechne), 1% penicillin/streptomycin (Invitrogen) ...
-
bioRxiv - Physiology 2021Quote: ... adiponectin and leptin assays were performed using a commercial ELISA kit (R&D System; Minneapolis, MN); The high molecular weight (HMW ...
-
bioRxiv - Microbiology 2021Quote: ... and CCL-5 (cat No. DY478) were also determined by mouse DuoSet ELISA (R&D Systems) in lung homogenates.
-
bioRxiv - Biochemistry 2020Quote: Recombinant proteins of human ACE2 extracellular enzymatic domain were purchased from R&D systems(933-ZN) and Sinobiological ...
-
bioRxiv - Bioengineering 2021Quote: ... the slides were incubated in 5 μg/mL solution of anti-SOX2 antibodies (R&D Systems) or 5 μg/mL solution of anti-Sox17 (SantaCruz ...
-
bioRxiv - Bioengineering 2021Quote: ... the medium was replaced with BPEL medium supplemented with 50 ng/ml VEGF (R&D systems) and 10 μM SB431542 (Tocris Bioscience ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Neuroscience 2021Quote: Plasma samples were assayed for FGF-21 levels using an ELISA kit from R&D Systems (MF2100 ...
-
bioRxiv - Microbiology 2021Quote: ... Positive testing controls for each ELISA kit were also included (R&D Systems QC20, QC61, & QC213). LBP was measured by standard ELISA using Hycult Biotech kit HK315-02 ...
-
bioRxiv - Neuroscience 2020Quote: ... Glass coverslips were coated with alternating stripes (IgG or Sema7a 100 μg/ml, R&D Systems), which were then covered by laminin (20 μg/ml) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human Cyto C Immunoassay 96-well plates followed by ELISA detection (R&D Systems, Minneapolis, MN). The fractional release of mitochondrial cytochrome c was calculated for each condition as [mean intensitysupernatant/(mean intensitymitochondria + mean intensitysupernatant)] ...
-
bioRxiv - Cancer Biology 2020Quote: ... Phosphorylation array was performed by using the human phosphor-kinase array kit (R&D systems, USA).
-
Salinomycin inhibits epigenetic modulator EZH2 to enhance Death Receptors in Colon Cancer Stem CellsbioRxiv - Cancer Biology 2020Quote: ... Proteome profiler Human Apoptosis array kit and recombinant human TRAIL were obtained from R&D Systems. Primers for GAPDH ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies for immunoprecipitation and Western blotting included anti-V5 and anti-His (R&D systems), Mouse anti-VAMP2 (SySy Synaptic Systems ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cell Biology 2021Quote: ... The level of IL-1β in cell culture supernatants was measured using ELISA (R&D systems) according to the manufacturer’s protocol.
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti-pro-EGF (against aa 700-800; Novus Biologicals, R&D Systems Europe Ltd, England), rabbit anti-APP C-Terminal (clone CT695 ...
-
bioRxiv - Pathology 2021Quote: ... Human MPCs were trypsinized and incubated 30 min with biotinylated anti-human PDGFRα (R&D system) and CD56-PE (clone B159 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then stained with phycoerythrin (PE)-conjugated anti-sheep secondary antibody IgG (F0126, R&D systems). Cell sorting was conducted on a BD FACSAria IIu cell sorter (Franklin Lakes ...
-
bioRxiv - Microbiology 2021Quote: ... and IP10 were determined using a Non-Human Primate Customized Multiplex (R&D Systems, Minneapolis, USA) following manufacturer’s instruction by using a Magpix (Luminex ...