Labshake search
Citations for R&D Systems :
751 - 800 of 1400 citations for Acyl CoA Dehydrogenase Very Long Chain ACADVL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... the nuclei were then stained with anti-SOX10 antibody (R&D Systems, AF2864, 1:250) + anti-Goat AF488 (Invitrogen ...
-
bioRxiv - Physiology 2023Quote: ... Further incubations with anti-VEGFR2 N-terminal antibody (rabbit, 1:100, R&D Systems, USA) and goat anti-rabbit IgG H+L Alexa Fluor 488 (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: Primary antibodies used for immunofluorescent staining were: active caspase-3 (Rabbit, R&D Systems, AF835); laminin alpha3 chain (Mouse ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-REL2 mouse monoclonal antibody (part # 844036) from the ELISA kits (R&D system) were used as capture antibodies for the enrichment of REL1 and REL2 proteins from cell lysate and clinical samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... Secondary antibody was added for ULBP 1 and 2/5/6 only (R&D Systems). Cells were then washed and fixed in 4% paraformaldehyde ...
-
bioRxiv - Cell Biology 2023Quote: ... Immunofluorescence staining on these sections involved primary antibodies against anti-CD45 (AF114, R&D Systems), Biotin-conjugated anti-podoplanin (127403 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Glypican 1 (GPC-1) biotinylated antibody was purchased from R&D systems (MN, USA). Biotinylated anti-CD63 ...
-
bioRxiv - Cancer Biology 2024Quote: ... whole blood samples were incubated with biotinylated antibodies against CD45 (R&D Systems, clone 2D1), CD66b (AbD Serotec ...
-
bioRxiv - Developmental Biology 2024Quote: The following antibodies were used: goat anti-PDGFR alpha 1: 200 (R&D Systems, AF1062), mouseanti-EZRIN 1:1000 (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... Immunocytochemistry was performed with primary antibody mouse anti-β(III)-Tubulin (R&D Systems, MAB1195) 1:500 ...
-
bioRxiv - Cell Biology 2020Quote: ... colonic tissues were incubated with a polyclonal antibody raised against c-Kit (mSCFR, R&D Systems, MN ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by incubation with antibodies against Nestin (MAB2736, 1:50, R&D Systems, Cambridge, MA, USA) or Ki-67 (NB600-1252 ...
-
bioRxiv - Cell Biology 2020Quote: ... and analyzed by SDS-PAGE and immunoblotting by using anti-Shh antibodies (R&D Systems, AF464). Signals were quantified with ImageJ and normalized to the highest protein amount detected in each run.
-
bioRxiv - Biochemistry 2022Quote: ... or 1:1000 anti-Human/Mouse/Rat PRL-3 Antibody (R&D Systems, MAB3219, Lot. WXH0419091). Following three washes with 0.1% TBST ...
-
bioRxiv - Bioengineering 2022Quote: ... The following primary antibodies were used in immunostaining: Anti-FOXA2 (R&D systems, #AF2400; 1:100), Anti-OLIG2 (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... We used following primary antibodies and dilutions: anti-(murine)SorCS2 1:1000 (#AF4237, R&D Systems), anti-DARPP-32 1:1000 (#AB40801 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and TNF-α-treated CM with FGF-2 neutralizing antibody (NAb; AF-233, R&D Systems). On day 7 ...
-
bioRxiv - Developmental Biology 2022Quote: The primary antibodies used in this study included goat anti-FOXF1 (R&D Systems, AF4798; RRID:AB_2105588), goat anti-GATA4 (Santa Cruz Biotechnology ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... and PTX3 levels were analyzed in duplicate using commercially available antibodies (all from R&D Systems, Minneapolis ...
-
bioRxiv - Neuroscience 2019Quote: ... and BSA (2%) and stained with following primary antibodies: PI16 (1:75, R&D Systems AF4929), GLUT1 (1:250 ...
-
bioRxiv - Neuroscience 2019Quote: ... The following primary antibodies were used in the study: PI16 (1:750, R&D Systems AF4929), α-SMA (1:1500 ...
-
bioRxiv - Cancer Biology 2019Quote: ... the following primary antibodies were used: mouse anti-human IFN-γ (R&D system, 1:1000), mouse anti-human ICAM1 (Abcam ...
-
bioRxiv - Cell Biology 2019Quote: ... The following antibodies were used: 1:100 goat anti-E-cadherin (R&D Systems (Minneapolis, MN)) ...
-
bioRxiv - Molecular Biology 2019Quote: ... or goat polyclonal primary antibody against cathepsin X (1:200, AF934, R&D Systems, MN, USA), diluted in blocking solution ...
-
bioRxiv - Physiology 2019Quote: ... Sections were incubated overnight at 4°C with primary antibodies against SOX9 (R&D Systems, AF3075), MMP13 (Protein Tech ...
-
bioRxiv - Developmental Biology 2021Quote: ... Unfixed cryopreserved embryos were sectioned and stained with sheep-anti-Prdm16 antibody (AF6295, R&D Systems) and FITC-conjugated anti-αSMA (F3777 ...
-
bioRxiv - Immunology 2021Quote: ... or 5 ug/ml isotype or neutralizing monoclonal anti-hIL-33 antibodies (R&D Systems, MAB36254), followed by stimulation with rIL-33 (Peprotech) ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies used for immunoblotting were sheep anti-DRAXIN (AF6149, R&D systems, 1 ug/mL), goat anti-β-ACTIN (AB0145-200 ...
-
bioRxiv - Bioengineering 2021Quote: ... the slides were incubated in 5 μg/mL solution of anti-SOX2 antibodies (R&D Systems) or 5 μg/mL solution of anti-Sox17 (SantaCruz ...
-
bioRxiv - Genomics 2020Quote: ... Antibodies used in this study were as follows: IL-33 (cat. no. BAF3626; R&D Systems), c-Jun (cat ...
-
bioRxiv - Neuroscience 2020Quote: Primary antibodies for immunoprecipitation and Western blotting included anti-V5 and anti-His (R&D systems), Mouse anti-VAMP2 (SySy Synaptic Systems ...
-
bioRxiv - Bioengineering 2021Quote: ... We performed the blocking experiment using an ACE2 polyclonal goat antibody (Cat # AF933; R&D systems) and CD147 (BSG ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then stained with phycoerythrin (PE)-conjugated anti-sheep secondary antibody IgG (F0126, R&D systems). Cell sorting was conducted on a BD FACSAria IIu cell sorter (Franklin Lakes ...
-
bioRxiv - Cancer Biology 2019Quote: ... TIM-3-Alexa Fluor 488 (344823) and TIGIT-APC (741182) antibodies (all from R&D Systems); CD4-APC-H7 (L200) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human alpha-Smooth Muscle Actin APC-conjugated Antibody (αSMA-APC) (R&D systems IC1420A, Clone #1A4) was added for 30 min before cells were washed in PW-buffer.
-
bioRxiv - Cell Biology 2021Quote: ... cells were incubated with an anti-Nluc antibody (R&D systems, MAB100261-SP, mouse, 1:500) in 1 % BSA/DPBS for 1 h at 4 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... and incubated overnight with primary antibodies PDGFRa (1:1000, AF-307-NA, R&D Systems, USA), Collagen 1 (Cat nb ...
-
bioRxiv - Cancer Biology 2021Quote: ... Sections were incubated overnight with anti-mouse NKp46/NRC1 antibody (1:500, AF2225 R&D system) and for 1h with rabbit anti-goat alexa647 conjugated secondary antibody (Invitrogen A21446) ...
-
bioRxiv - Cell Biology 2020Quote: The following primary antibodies were used in Western blotting experiments: anti-MTf (R&D systems, MAB8175), CD63 (Abcam ...
-
bioRxiv - Developmental Biology 2022Quote: ... The following primary antibodies were used: goat anti-ACE2 (R&D Systems, USA, AF933, 1:100), mouse anti-TMPRSS2 (Developmental Hybridoma Bank ...
-
bioRxiv - Bioengineering 2022Quote: ... Human α-Smooth Muscle Actin (SMA) Alexa Fluor® 647-conjugated antibody (R&D Systems-IC1420R) diluted 1:200 was introduced for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were incubated in different concentrations of goat anti-mouse Nrp1 antibody (R&D Systems, AF566) or 1 μg/mL of goat anti-mouse PDGFRα antibody (R&D Systems ...
-
bioRxiv - Neuroscience 2021Quote: ... We used following primary antibodies and dilutions: anti-murine-SorCS2 1:100 (#AF4237, R&D Systems), anti-DARPP-32 1:100 (#AB40801 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the following primary antibodies were used: anti-human PTN (1:200; R&D systems, AF252-PB), anti-PanCK ...
-
bioRxiv - Cancer Biology 2022Quote: ... and then incubated overnight at 4°C with goat polyclonal antibody to ST6GAL1 (R&D Systems) (see Table S3 for antibody information) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Anti– Siglec-9 antibody (5 μg mL-1; clone 191240, #MAB1139-500, R&D systems, USA) or human IgG isotype control (#31154 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Commercial antibodies in this study were as follows: GPX1 (Catalog #AF3798, R&D Systems, Minneapolis, MN), GPX3 (Catalog #AF4199 ...
-
bioRxiv - Immunology 2020Quote: The following primary antibodies were used for flow cytometry: anti-MICA (clone 159227; R&D Systems) and anti-MICB (clone 236511 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Primary antibodies used for immunolabelling are as follows: goat polyclonal Sox9 (AF-3075, R&D Systems), rabbit monoclonal GSK3alpha (ab40870 ...