Labshake search
Citations for R&D Systems :
501 - 550 of 2762 citations for Recombinant Human LDLR protein GST tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 200 IU/ml of recombinant human IL-2 (R&D Systems, 202-IL-050) and expanded for 10 – 14 days ...
-
bioRxiv - Bioengineering 2022Quote: ... recombinant human granulocyte-macrophage colony-stimulating factor (GM-CSF) (R&D Systems, Minneapolis, MN), recombinant human interleukin 4 (IL-4 ...
-
bioRxiv - Microbiology 2023Quote: ... supplemented with 20 ng/mL of recombinant human oncostatin M (OSM, R&D systems). For the co-culture experiment ...
-
bioRxiv - Immunology 2024Quote: ... and 10ng/mL of recombinant human IL-4 (R&D systems, #204-IL/CF). Inhibitors used were the PI3Kdelta inhibitor Idelalisib ...
-
bioRxiv - Immunology 2024Quote: ... 2mM L-Glutamine and 20ng/mL of recombinant human IL-3 (R&D systems). Cas9 and gRNA components were assembled into RNP per the manufacturer’s instructions and transfected into pDC 16 hrs p.c ...
-
bioRxiv - Biochemistry 2023Quote: Recombinant human angiogenin (catalog number 265-AN/CF) was purchased from R&D Systems, a Bio-Techne Company (Minneapolis ...
-
bioRxiv - Cell Biology 2024Quote: ... and recombinant human or murine Fc-ICAM-1 (10 μg/ml) (R&D Systems) coated plates ...
-
bioRxiv - Biochemistry 2024Quote: Human recombinant CatA was first activated by following the manufacturer’s instructions (R&D Systems), incubating at 37°C 10 µg/mL CatA with 1 µg/mL CatL in an activation buffer (25 mM MES pH = 6.0 ...
-
bioRxiv - Bioengineering 2024Quote: ... along with 50 ng/ml recombinant human GDNF (R&D Systems, 212-GD-010) were administered for 12 hr ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant human Wnt-3a (rhWnt-3a) (#5036-WN, R&D Systems; Minneapolis, Minnesota, USA) was resuspended according to manufacturer’s instructions and stored at −80°C.
-
bioRxiv - Genetics 2023Quote: ... and recombinant human FGF2 at 20 ng/uL (R&D systems #233-FB-010).
-
bioRxiv - Cancer Biology 2023Quote: ... and 100 ng/mL of recombinant human IL-17B (R&D Systems, Minneapolis, MN) for 48 h and processed for downstream RNA expression analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 ng mL− 1 BMP-4 (human recombinant) (R&D Systems, Minneapolis, MN, USA), 10 µM LY294002 (Cayman Chemical ...
-
bioRxiv - Biochemistry 2023Quote: ... we used commercial recombinant human OGT fragment (Cys323-Glu1041) (R&D systems, 8446-GT). Thereafter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 200ng/mL recombinant Human Wnt3a (R&D System, Cat. No. 5036-WN-010/CF) or Wnt5a (R&D System ...
-
bioRxiv - Immunology 2023Quote: ... and 1 ng/ml recombinant human basic fibroblast growth factor (bFGF)(R&D Systems). Human MSCs were obtained from ATCC (catalog #PCS-500-012 ...
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human M-CSF (R&D Systems 216-MC-100) at 37°C for seven days.
-
bioRxiv - Immunology 2024Quote: ... and 10ng/mL of recombinant human IL-7 (rh IL-7; R&D Systems). PBMCs treated with 0.1ug/mL of SEB were supplemented with 10ng/mL of rh IL-7 alone ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 µg/mL of a recombinant human efnB2-Fc (R&D Systems, U.S.A.). Both recombinant proteins were pre-clustered with 10 µg/mL of an anti-human IgG antibody (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2024Quote: ... with or without 1 ng/mL recombinant human BMP9 (R&D Systems, Minneapolis, MN) for an additional 24 hours ...
-
bioRxiv - Immunology 2024Quote: ... Human and mouse recombinant cytokines and ELISA kits were purchased from R&D Systems and were declared by the manufacturer to contain <0.1 ng of LPS per μg of protein ...
-
bioRxiv - Biochemistry 2024Quote: ... + 10% FBS + 50ng/ml Recombinant Human SCF/c-kit (R&D Systems, PRD255-50), 50ng/ml Human TPO (Peprotech ...
-
bioRxiv - Developmental Biology 2024Quote: ... 80 ng/mL recombinant human R-spondin 1 (R&D systems, 4645-RS-100), 100 ng/mL recombinant human FGF2 (Peprotech ...
-
bioRxiv - Neuroscience 2020Quote: ... while MABs differentiation into myotubes was initiated in the opposite compartments using MAB differentiation medium containing 2% horse serum (Cat N° 16050122) and 1% sodium pyruvate in DMEM/F12 supplemented with 0.01 μg/ml recombinant human agrin protein (R&D Systems, Cat N° 6624-AG-050). At day 21 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Endoderm lineage explants were generated using recombinant activin protein (R&D Systems) at a final concentration of 160 ng/mL in 1XMMR supplemented with 0.1% BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... or recombinant mouse Sema3F-Fc fusion protein (R&D Systems #3237-S3) (5 nM ...
-
bioRxiv - Systems Biology 2021Quote: ... Recombinant Mouse IGF-I/IGF-1 Protein (10ng/ml, R&D Systems), Transforming Growth Factor (TGF)β1 (10ng/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 1% ITS+premix and 100ng/ml recombinant CCL2 protein (R&D Systems) or 1% BSA for the control were placed on uncoated or Matrigel coated inserts in the upper compartment ...
-
bioRxiv - Neuroscience 2023Quote: ... or recombinant mouse Sema3F-Fc fusion protein (R&D Systems #3237-S3) at 5 nM for 30 minutes ...
-
CXCL17 binds efficaciously to glycosaminoglycans with the potential to modulate chemokine signallingbioRxiv - Immunology 2023Quote: ... Recombinant proteins were from R&D systems (Bio-Techne Ltd., Abingdon, UK). Heparin dp8 and heparan sulfate used in the bio-layer interferometry (BLI ...
-
bioRxiv - Immunology 2023Quote: ... using either PCSK9 peptides or recombinant mPCSK9/hPCSK9 protein (R&D Systems) as the coating antigen ...
-
bioRxiv - Neuroscience 2023Quote: ... Recombinant IL-1β and TNF-α proteins were from R&D Systems. Human IL-6 ELISA kit was from Life Technologies ...
-
bioRxiv - Immunology 2024Quote: ... comprised of recombinant mouse IL-15 protein (R&D Systems, Minneapolis, MN) and recombinant mouse IL-15Ralpha Fc chimera protein (R&D Systems) ...
-
bioRxiv - Immunology 2024Quote: ... recombinant mouse IgG2A Fc protein provided a Fc control (R&D Systems). His-tagged versions of rEFNA1 ...
-
bioRxiv - Systems Biology 2024Quote: ... Recombinant Mouse BMP-7 Protein (R&D Systems, 5666-BP-010/CF), or BSA ...
-
bioRxiv - Biochemistry 2020Quote: In vitro co-precipitation of TREM2 or TREM1 with Aβ oligomers was performed by mixing recombinant Fc-tagged TREM2 or TREM1 ectodomain (residues 19-171; 100 ng/ml, R&D systems), 100 nM HiLyte Fluor 647-labelled Aβ oligomers and Protein G Dynabeads in 0.5% fatty acid free BSA PBS-Tween buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The pre-immobilized beads were then incubated with 50 nM recombinant mouse SorCS1 ectodomain tagged with a C-terminal 6-His tag (SorCS1-His, Cat# 4395-SR-050, R&D systems) in ECS for 2 h at 4 °C ...
-
bioRxiv - Genomics 2020Quote: ... cells were stained with a fluorescently-conjugated antibody against LDLR (R&D Systems, Minneapolois MN, FAB2148G). CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961 ...
-
bioRxiv - Bioengineering 2021Quote: Recombinant human IDO expressed in Escherichia coli was purchased from R&D Systems (Minneapolis, MN) with a predicted molecular mass of 46 kDa a specific activity of >500pmoles/min/μg (or for equimolar calculations >29 pmol NFK/min/pmol IDO ...
-
bioRxiv - Cancer Biology 2020Quote: ... 10 ng/ml IL6 + 0.1 ng/ml recombinant human sgp130-Fc (R&D Systems, Germany) or 20 ng/ml Hyper-IL6 (kind gift of S ...
-
bioRxiv - Microbiology 2020Quote: ... infected HFF monolayers were stimulated with 100U/mL recombinant human IFN-γ (R&D Systems) 24 hours post-infection and fixed 6 hours post-stimulation ...
-
bioRxiv - Cancer Biology 2020Quote: ... CMK lines were treated with 200 ng/ml of recombinant human WNT3A (R&D systems) for 4 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng ml−1 of recombinant human TNFα (R&D Systems, 210-TA-020/CF) or a combination of both ...
-
bioRxiv - Neuroscience 2022Quote: ... and 2 ng/ml recombinant human NRG1-β 1 (#396-HB, R&D Systems, USA) as described in Poitelon et al ...
-
bioRxiv - Molecular Biology 2022Quote: Human recombinant BMP-2 and BMP-4 were purchase from R&D Systems (Minneapolis, MN). Anti-Myc and anti-HA antibodies were purchased from Cell Signaling Technology (Danvers ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant human versican isoform V3 and lumican were from R&D Systems (Minneapolis, MN, USA). Recombinant human versican protein G1 and G3 domains (ab152303 and ab236178 ...
-
bioRxiv - Molecular Biology 2020Quote: Mice fibroblast cells (FLS) treated with 5 ng/mL recombinant human TNF (R&D Systems) for 16 hours were harvested at 95% confluence ...
-
bioRxiv - Immunology 2022Quote: ... 625 or 312.5 ng/mL recombinant human IL13Rα1-Fc chimera (R&D Systems Cat#146IR) or IL13Rα2-Fc chimera ...
-
bioRxiv - Cancer Biology 2022Quote: ... human recombinant epidermal growth factor (20 ng/ml; #236-EG-01M, R&D systems, USA), human recombinant fibroblast growth factor (20 ng/ml ...
-
bioRxiv - Immunology 2020Quote: ... Monocytes were stimulated for 18hrs with 100U/mL recombinant human IFN-β (R&D systems) and processed for RNA extraction.